2008年秋小学语文六年级期中检测试卷

What are Microsatellites?,D2S123,TAGGCCACACACACACACACA,UniquePrimer, Mono, di, tri, tetra nucleotide repeats HNPCC - Expansion/contraction of nl repeats,Strand Slippage,D2S123,TAGGCCACACACACACACACA,UniquePrimer,14 bp,12 bp,TAGGCCACACACACACACACA,13-15 BP,4-40 RPTS,Mis-Match Repair Genes, hMSH2 hMLH1 PMS1 PMS2 hMSH3 hMSH6,Click for larger picture,Click for larger picture,Risk of CRC in ClinicalHNPCC Families: Netherlands,Age 44 69 Locationpr: 53%pr: 32%ds: 41%ds: 68% CI35 10% .07% CI50 24% .5% CI75 42% 5.3%,HNPCC,Voskuil, Int J CA 1997;72:205,Sporadic,Risk of CRC in MSH2/MLH1HNPCC Families: Netherlands,CRC Lifetime80Women83Men92Endometrial50,%,Vasen, Gastro 1996;110:1020,HNPCC, 90% of tumors show MI Germline defect in MMR genes 2nd Hit - Somatic Mutation,MSI in Sporadic CRC, 10 - 15% of sporadic CRC In HNPCC: Germline + somatic = MSI Sporadic - biallelic somatic mutation via methylation of MLH1 promoter,TC = Transcription Complex,Click for larger picture,Gene Testing for hMLH1 or hMSH2, DGGE SSCP IVSP Direct Sequencing,Gene Testing,Sensitivity,Cost ($),Sequencing 90% 800 - 3,000CSGE & Sequencing 90% 1500Screening (SSCP) 95 - 100% 800Screening (PTT) 50 - 60% 750MSI NA 300,Gastro 2001;121:195,Gene Testing for MSH2/MLH1,509 Finnish CRC pts,63 MSI,10 (2%) MMR mutations,5/10 Founder mutation 7/10 Amsterdam Criteria All either young, had fam hx, or previous CA,Aaltonen, NEJM 1998;38:1481,Predictive Model for MMR Gene Testing,184 Kindreds: 26% w/ MMR mutations 1) Mean age at diagnosis of affecteds 2) At least 1 member w/ Endometrial CA 3) Amsterdam Criteria,Wijnen, NEJM 1998;339:511,Predictive Model for MMR Gene Testing,Wijnen, NEJM 1998;339:511,Logistic Model,Prob 20%,MSI,+,-,Nothing,MMRAnalysis,MMRAnalysis,Bethesda Criteria and MMR Mutation,+ BC,- BC,N58 (46%)67 (54%) 125MSI17 (29%) 5 (7.5%) 22 (18%)MMR Mutation11 (65%) 0 (0%) 11 (9%)B1 - B446 (79%),N=125, “high risk”, Frankfurt, GE,Total,Raedle, Ann Int Med 2001;135:566,Bethesda vs. Amsterdam,Sens,Amsterdam 6/6 27 94Amsterdam II 8/10 46 90Bethesda 11/17 77 60,Spec,Raedle, Ann Int Med 2001;135:566,MMR Mutation MSI status,Criteria to predict MSI,Cost Effectiveness of MSI, Decision tree using MSI (Bethesda guidelines) and MMR mutations 90% CI for cost-effectiveness of screening patients with cancer & relatives: $4,874 - 21,576 / life year gained Sensitivity analysis - prevalence HNPCC mutation #1 factor,Ramsey, Ann Int Med 2001;135:577,Click for larger picture,Mutations in HNPCC Kindreds, 32 Kindreds (N=38) in Buffalo and Vermont Amsterdam Criteria,Weber, Cancer Res 1997;57:3798,Incidence of Mutations MSH2/MLH1:,25%,Conclusion:, Molecular basis unknown for many subjects,Effectiveness of Screening in HNPCC, 252 subjects, 22 Families (119 Control, 133 screen) Colon q3yrs, 1984, 15 yr F/U Not randomized - declined participation,Jarvinen, Gastro 2000;118,Screen,CRC8 (6%) 19 (16%) .4 .01Mutation + 18% 41% .4 .02Deaths to CRC 0 8%.001,Control,OR,P,Click for larger picture,Risk of Metachronous CRC,Colonoscopy in High Risk Individuals,31 HNPCC Families - 232 Individuals86 (38.6%) underwent colonos-compared to controls,Ponz de Leon, CEBP 1998;7:639,Case Control P,CA 5 1Adenomas 29 11 .03TV/V (#) 11 1Ad Diam 9.15.8 .02HGD (#) 9 3,Center for Families at Risk for CRC,Goal: To develop a registry of high risk families To assemble blood/DNA for research,Recruitment: Physician referral, Media, UPCI CA Registry,High Risk Definition: Young onset, FDR young onset, Multiple cancers,Overall: 83 individuals (76 families),Jan 98 - June 00,UPCI Registry,Young onset cancers - 45, 45-55,188,106,82,26,11 (5.9%),23,33,Alive,Dead,Agreed,NotInterested,Enrolled,Unavailable,High Risk Patients,67.1% High Risk,23 Young Onset (55) 9 Multiple CAs15 Young and Multiple (8 Amster