BMPactivepeptidesinvitroinducedBMSCsosteogenicdifferentiationoftheexperimentalstudy

1、 bmp 2 active peptides in vitro induced bmscs osteogenic differentiation of the experimental study abstract bone morphogenetic protein 2 (bmp 2) has a strong induction of rat bone marrow mesenchymal stem cells (bmscs) to the direction of orientation osteogenic differentiation capacity. natural bmp 2

2、 limited number of complex structure limits its wider application. in this experiment were designed and synthesized bmp 2 active peptides, in vitro tests to explore the direction of bmscs to the osteoblast-directed ability to induce osteogenic differentiation, the evaluation bmp 2 active peptides in

3、duced bone effects. methods experiments were divided into two groups, induction group and the non-induced group. to take a 4-week wistar rats were isolated and cultured bmscs, spread to the 3rd generation, the experimental group in favor of osteogenic induction medium (dmem complete medium bmp 2 act

4、ive peptides 200 g / ml). the non-induced group, still using dmem complete medium. continue to develop 2 to 4 weeks, using cell seeded culture, alkaline phosphatase activity and calcium content determination, real-time quantitative pcr detection of type collagen (col ) and osteopontin (opn) mrna exp

5、ression, evaluation of bmp 2 active peptides induce osteogenic potential in vitro. results induced group bmscs grew well, showing typical osteoblasts similar morphological features and biological characteristics, alp activity increased, calcium content increased, col , and the mrna was highly expres

6、sed opn. the non-induced group, osteogenic properties was not obvious. conclusion the synthesis of bmp 2 active peptides can effectively contribute to the direction of differentiation of bmscs to differentiate into bone, is an ideal bone tissue engineering bone inducing cytokines. has the natural bm

7、p 2 similar to the bone induction activity, and has broad application prospects. keywords: bmp 2 active peptides of bone marrow-derived mesenchymal stem cells into the bone lead abstract: objective to investigate the capability of synthesis bmp 2 derived peptide on osteogenic induction in bone marro

8、w stem cells (bmses), and to evaluate the osteoinductivity of bmp 2 derived peptide in vitro. method after segregating and cultivating four weeks wistar rats marrow stromal cells in induction group were induced by osteogenasis medium containing 200 gg / ml bmp 2 derived peptide, and in non induction

9、al group bmscs were still culture with dmem medium.following continue culture for 2 4 weeks , cells film preparation, alkaline phosphatase activity and calcium deposition were measured.type i collagen (com) and osteopontin (opn) mrna expression were measured using real time fluorescent quantitative

10、polymerase chain reaction (fq pcr) technique.the capability of synthesis bmp 2 derived peptide on osteogenic induction of bmscs was investigated. result after inductived with bmp 2 derived peptide.bmscs cultured survived well greatly changed in cell morphology, and showed a biological and morphologi

11、e characteristics similar to those of osteoblasts.the lever of alkaline phosphatase activity and calcium deposition increased.col and opn mrna were expressed at higher level.in non inductional group no conspicuous osteogenic induction was shown. conclusion bmp 2 derived peptide can induce bmscs to d

12、ifferentiate into osteoblasts. it has the similar capacity of osteogenic induction as nature bmp 2, so bmp 2 derived peptide is an ideal cell agent for bone tissue engineering, and can be available widely. keywords: bmp 2 derived peptide; bmscs; osteoinductivity bone marrow stromal cells (bone mesen

13、chymal stem cells, bmscs) with multilineage differentiation potential, under the action of certain cytokines may apply to the direction of osteoblast differentiation, bone tissue engineering has become an ideal seed cells 1. bone morphogenetic protein (bone morphogenetic proteins, bmp) belonging to

14、tgf superfamily, is a multifunctional growth factor, in which bmp 2 is the main regulator of bone formation 2,3. a limited number of natural bmp 2, and the biological activity is difficult to play 4,5. in this study, according to bmp 2 amino acid sequences of the core functional area, solid-phase sy

15、nthesis synthesis of a 24-nucleotide-containing peptides - bmp 2 active peptides in vitro induced bmscs to differentiate into bone in the direction of directional differentiation, evaluate the effectiveness of induction. 1 materials and methods 1.1 main apparatus and reagents inverted phase contrast

16、 microscope (axiovert35, zeiss corp, germany); sugar dmem medium (cibco); fetal bovine serum (cibco); trypsin (sigma); alkaline phosphatase (alp) activity kit (nanjing jiancheng bio-engineering inter - co., ltd.); cellular calcium kit (sigma corporation); bmp 2 active peptides (in this research grou

17、p and was jointly developed by gl biochem shanghai co., ltd.). 1.2 bmscs isolation and culture take 4-week-old healthy wistar rats 2, by the experimental animal center of tongji medical college to provide and weighing about 120 g, either sex, 10% of the intraperitoneal injection of chloral hydrate a

18、nesthesia, bilateral lower extremity shearing, 75% ethanol 30 min immersion disinfection (to be rats first exposed to the outside), under sterile conditions, bilateral tibia and femur removed, cut off bone side of no. 10 syringe extraction 1 ml dmem complete medium (containing 20% fetal calf serum,

19、100 mg / ml penicillin, 100 mg / ml streptomycin) since the end of the wash, made into single cell suspension to 3 104/ml cells were inoculated to 100 ml culture bottle, placed in 37 , 5% co2 and saturated humidity incubation box, 24 h, the whole volume of exchange fluid, thereafter every 3 d for li

20、quid 1. after the cells to be merged into a single layer, with 0.25% trypsin digestion and passage to 1:3. 1.3 bmscs cultured in osteogenic induction obtained in vitro amplification of the 3rd passage cells to 1 105 ge / cm2 inoculated into the pre-planting density of 6-well plate cover slip in subc

21、ultured. the passage cells were divided into two groups, induced group: cultured 24 h after the switch to osteogenic medium (dmem complete medium bmp 2 active peptides 200 g / ml). the non-induced group: it is still using dmem complete medium. group 2 continuous cell culture, conventional 3 4 d for

22、fluid 1, cell morphology and biological characteristics of detection. 1.4 intracellular alkaline phosphatase (alp) activity and calcium content detection osteogenic induction medium 5,10,15, and 20 d culture, it will be 6-well plates in the cells washed two times with pbs, 0.25% trypsin digestion 5

23、8 min, each well by adding 1 ml culture medium to terminate digestion, 4 10 000r/min centrifuge 5 min, then pbs washed three times, plus cell lysate rupture of membrane. press kit for alp activity detection. was measured at 520 nm wavelength absorbance (a value). of calcium content: dishes washed tw

24、o times with pbs, add 1 ml 0.5mol / l hcl, oscillation overnight, next day 10 000r/min centrifuge 5 min, the supernatant with calcium kit (sigma company) determination of calcium content. each supernatant obtained 20 l, with equivalent non-ionic water as blank control, according to kit instructions,

25、 at 575 nm wavelength measured a values. 1.5 real-time fluorescence quantitative rt pcr detection of col and opn mrna expression in 1.5.1 primer design in the ncbi search-to-rat col and opn gene, to find the genes mrna, with primers designed using primer 5, from shanghai boya biotechnology co., ltd.

26、 synthesis of primers. col primer sequence: forward primer: 5 cagacgggagtttctcctcggacgt 3; reverse primer: 5 gaccaggaggaccaggaagtccacgt 3; opn primers: forward primer: 5 tggtttgcctttgcctgttcg 3; reverse primer: 5 atggctttcattggagttgcttg 3; actin primers: forward primer: 5 agcagagaatggaaagtcaaa 3, re

27、verse primer: 5 atgctgcttacatgtctcgat 3. 1.5.2 rat bmscs inoculation treatment and cell collection will grow well in the first three-generation bmscs to 1 105 ge / cm2 coverslip pre-inoculation density of the six-well plate, bmp 2 active peptides induced group cultured 24 h after switching to osteog

28、enic induction medium. the non-induced group was still using dmem complete culture medium; in the first 14 d when the cells were collected by trypsin digestion method. each group were 3-hole fq pcr retest. reposted elsewhere in the paper for free download 1.5.3 real-time fluorescence quantitative pc

29、r reaction (fq pcr) experiments carried out by trizol reagent instructions. sybr green i fluorescent dye (purchased from the united states biotium companies). pcr reaction conditions: 94 30 min, 53 30 min, 72 30 min, 50 cycles. 1.5.4 statistical processing application of fluorescent dye sybr green l

30、ine real-time quantitative pcr reaction technique to obtain specimens of the standard curve of each group, the computer analysis of ct values. 2 results the morphological changes of 2.1 bmscs were observed under inverted phase contrast microscope, bmscs cells were round or oval, isolated and culture

31、d 12 h beginning adherent, were round or oval. 3 d cell proliferation, a greater number of spindle-shaped or polygonal. 5 7 d, cell numbers increased significantly, showing single-layer growth. can be covered with bottom of the bottle. induced group containing bmp 2 active peptides 200 g / ml in ost

32、eogenic induction medium 3 4 d, the cultured cells showed obvious morphological changes, from the spindle into a stout spindle or polygonal. 2.2 alp activity and calcium content determination group 2, respectively, 5,10,15, and 20 d, when cultured cells were collected, according to test kit instruct

33、ions. each group of five holes to x- s indicated (figure 1 2). 2.3 rt pcr detection of col and opn mrna expression in of rat bmscs in the two groups after 14 d culture medium, col and opn mrna were expressed (table 1). table 1 sets induced by 14 d after the col and opn mrna in ct values (n = 3) col

34、mrnaopn mrnabmp2 active peptides induced group 23.80 0.23 * 25.54 2.72 * non-induced group 34.56 3.8536.03 3.54f value of 18.4316.57 * single-factor analysis of variance, in the = 0.05 level, f> 7.71, there was significant statistical difference. figure 1-induced group and non-induced group figur

35、e 2-induced alp activity group and non-induced changes in calcium content of 3 group discussion bmp 2 is a special biological activity of cytokines, can induce bmscs to differentiate into bone differentiation. promotion of bone formation and osteoblast-specific expression of secreted products, such

36、as the col , opn and ocn, etc. extracted from the bone tissue of natural bmp, cumbersome methods, harvest less, low purity and poor reproducibility 4,5, it is difficult to meet the needs of research and clinical application. therefore, how rational and effective synthesis of bmp 2 has become todays

37、scholars are concerned about hot spots. at present many different types of synthetic peptides, the effectiveness of different opinions. guo xiaodong, et al 6,7 bmp 2 with the synthetic active peptides dropping on the collagen sponge on the back side of the sacral spine in the rat muscle under the em

38、bedding, 8 weeks, subjects, x-ray, histological examination, carried out a comparative observation on ectopic bone formation. the results showed that: implanted area shows significant new bone formation, with active bone cells and trabecular bone growth a very good organization. 8 poon hoi and other

39、 solid-phase synthesis with the synthesis of k16grgdspc oligopeptide, bmscs significantly increased gene transfection and expression. saito et al 11 9 bmp 2 nucleotide sequence according to the different functional areas of the seven synthetic peptides, and compare its features, find that under bmp

40、2 core functional areas of the nucleotide sequence of the synthesis of bmp 2 activity peptide, can induce mouse pluripotent cells c3h10t1 / 2 osteogenic differentiation, the alkaline phosphatase activity was significantly higher, with a total price of alginate gel after the implantation of rat gastr

41、ocnemius muscle, the 3 weeks after the implantation zone bone mineral density up to 250 mg/cm3, x-ray findings are almost the same as the tibia. yoshihisa et al 12 synthesized containing 20 amino acids of a bmp 2 active peptides it with alginate hydrogel composite, discovery and bmp 2 has the same b

42、iological activity, can induce ectopic bone formation. this experiment is the bmp 2 nucleotide sequence of the core functional areas, through the fmoc / tbu solid phase peptide synthesis synthesized with 24 amino acid oligopeptide - bmp 2 active peptides, bmp 2 active peptides contained in phosphory

43、lated serine, and aspartic acid can be an excellent mimic natural bone matrix mineralization in the stimulation and guidance functions in the formation of piansuan local environment for the local deposition of calcium and phosphorus, into the nuclear and biological self-assembly mine of. at the same

44、 time, short-chain peptides active site can be fully exposed and with the cell surface receptor binding, biological activity of a stronger, it is combined with the collagen sponge materials, the stability of the process better, the composite of collagen sponge with a gradual body degradation of the

45、release and duration 13. and, bmp 2 peptide-induced growth factor as a molecular signal, through specific cell communication and information transmission system for cell adhesion and to the direction of directional differentiation of osteoblast-biological behaviors such as precise control, that has

46、a very good bone inducing activity. its molecular weight is small, spiral-shaped space structure, active site easy to exposure, functioning and stability. previous research also confirmed that the bmp 2 active peptides with in vitro induced bmscs to the direction of differentiation of bone 14,15. al

47、kaline phosphatase (alp) and calcium content of mature osteoblasts one of the hallmarks of its level of activity may also reflect the maturity of osteoblasts. col for bone tissue in the synthesis of osteoblast-specific collagen, col amount reflects the maturity of osteoblasts. the results show that:

48、 the conditions of culture medium 3 4 d later, cultured cells showed obvious morphological changes, from the spindle into a stout spindle or polygonal, showing a clear trend of osteogenic differentiation. with the conditioned medium of bmp 2 active peptides increasing the concentration of osteogenic

49、 cells to change the time to be ahead of schedule. alp activity detection: bmp 2 active peptides induced group compared with non-induced alp was significantly increased and reached the peak in the induced 15 d later into the plateau. similarly, the calcium content of bmp 2 active peptides induced gr

50、oup also significantly increased compared with non-induced group. type collagen and osteopontin mrna expression by real-time quantitative rt pcr detected: inoculation 14 d, col mrna, and opn mrna in osteogenic induction media groups have expressed bmp 2 further illustrates the activity of more than

51、peptide in vitro induced bmscs osteogenic differentiation role. 【references】 1 ebara s, nadayama k. mechanism for the action of bone morphogenetic proteins and regulation of their activity j. spine, 2002,27 (16 suppl 1): 10 15. 2 zheng, xin-sheng qi. bone morphogenetic protein in repair of bone defe

52、cts and necrosis of bone-forming mechanism and the use of j. chinese journal of orthopedic surgery, 2004,12 (23,24): 1888 1890. 3 ma wenhui, when shu-shan, li yafei. bone repair of bone morphogenetic protein (bmp) into the bone status of the mechanism and its application j. chinese journal of orthop

53、edic surgery, 2001,8 (2): 167 170. 4 wozney jm, seeherman hj.protein based tissue engineering in bone and cartilage repair j. curr opin biotechnol, 2004,15 (5): 392 398. 5 saito n, takaoka k. new synthetic biodegradable polymers as bmp carriers for bone tissue engineering j. biomaterials, 2003,24 (13): 2287 2293. 6 guo xiaodong, yuan quan, zheng qi-xin, et al. with a bone inducing activity of the preparation of biomimetic bone matrix material j. chinese journal of experimental surgery, 2006,23 (8): 213 217. 7 guo xd, yuan q, zheng qx, et al.biologically inspired self assembli