质粒提取与酶切电泳实验报告

1、preparation of plasmid dna, restriction enzyme digestion, andagarose gel electrophoresis2014/10/14-211 intro1.1 objectiveto learn the characteristics of plasmid dna the method of plasmid dna mini-preparation by alkaline lysis and the measurement ofdna concentration by spectrophotometer the character

2、istics of restriction endonuclease how to use agarose gel electrophoresis to separate dnasto understand:the principles of purification and quantification of plasmid dna1.2 principle1.2.1 plasmid and vectorplasmid is a small, independently replicating, piece of extrachromosomal cytoplasmic dna( doubl

3、e stranded and usually circular ) that is capable of autonomous replication and can be transferred from one organism to another.vector serve as carriers to allow replication of recombinant dna in the host cell, usually a vector covers antibiotic resistance gene: such as ampicillin resistant gene, ka

4、namycine resistant gene, and etc. origin of replication (ori ) multiple cloning site (msc) or polylinkcr marker genes: such as lacz gene.1.2.2 alkaline lysis ( 0.2molnaoh + 1%sds )sds is a kind of anionic detergent. it can break bacterial cells and denature proteins when bacterial cell wall is broke

5、n, the plasmid dna and genomic dna will be released out and be denatured in alkali environment. when the solution is neutralized by acidic reagent (such as kac), the plasmid dna will be renatured rapidly due to its smaller size. after centrifugation, the plasmid dna will be in supernatant, while the

6、 genomic dna will stay in the sediment at the bottom of the tubes together with other cell debris.123 dna concentration measurementbased on the strong absorbance of base pairs (a-t, g-c) at 260nm uv, the concentration of dna can be measured by spectrophotometry. when detected under neutral condition

7、, a260 is used to calculate the nucleic acid concentration where as the ratio of a260/a280 can be used to estimate the purity of nucleic acid (1.8 for pure dna).124 restriction endonucleasetypcii re cuts dsdna at specific restriction sites on specific sequence, producing restriction fragments.1.2.5

8、gel electrophoresissolidified agarose solution has certain size of small pores of which the size is decided by concentration. in the electric field and buffer in neutral ph, negatively charged nucleic acid will migrate toward the positive pole. dna fragments can be separated by different mobility in

9、 gel electrophoresis.1.2.6 eb ( ethidium bromide )eb can bind with dna through inserting into the base pairs of dna molecule. excited by uv, the dna bands in gel electrophoresis will emit red fluorescence which can be detected easily. the minimal dna quantity that can be tested by this method is abo

10、ut long.2 materials and reagents e.coli dh5 harboring pcmv-myc-tl o(sipar) tianprcp mini plasmid kitpl: (1 % glucose, 50mm/l edtap h&o, 25mm/l tris-hcl ph&o)p2: 0.2 mm/l naoh, 1 % sdsp3: 5 mol/l kac, ph4.8 plasmid pcmv-myc-sipar neb lkb dna ladder ecori, xhol (takara) 10xh buffer agarose tbe

11、/tae bufter(lx) eb (lomg/ml) loading buffer(3 x):0.25% bromophenol blue 40%(w/v) sucrose or 30 % glycerol3 procedures3.1 preparation of plasmid dnaa. add 500 u 1 buffer bl to spin column cp3. centrifuge for 1 min at 12,000 rpm in a table-top microcentrifuge. discard the flow-throw, and place spin co

12、lumn cp3 into the collection tubeb. harvest 1.4 ml bacterial cells in a microcentifuge tube by centrifuge for 1 min at 12,000 rpm for 1 min at 20°c, then remove all the traces of supernatant. then redo with 1.4ml bacterial cells in another microcentifuge tubec. resuspend pelleted bacterial cell

13、s in 250 u 1 buffer pld. add 250 p 1 buffer p2 and mix thoroughly by inverting the tube 6-8 timese. add 350 u 1 buffer p3 and mix immediately and thoroughly by inverting the tube 6-8 timesf. centrifuge fbr lomin at 12,000 rpmg. apply the supernatants to the spin column cp3, centrifuge for lmin at 12

14、,000 rpmh. wash the spin column cp3 by adding 700 u i buffer pw and centrifuge for lmin at 12,000 rpm. discard the flow-through, wash again with 500 u 1 buffer pw and centrifuge for lmin at 12,000 rpm.i. discard the flow-through and centrifuge for 2min at 12,000 rpmj. place the spin column cp3 in a

15、clean 1.5ml microcentrifuge tube. add 50 p 1 eb, let stand for 4min, and centrifuge for 2 min at 12,000 rpm.3.2 restriction enzyme digestion and agarose gel electrophoresisa. enzyme digestion of plasmid dna (pcmv-myc-sipar)table 1plamid(ng)buffer( p 1)*ecorl(ul)h2o( p 1)total volumn( n 1)i20120016.5

16、20ii20120.5016.020iii20120.50.515.520digestion at 37 °c water bath for 1 hour.add 10(il 3x loading buffer to each tube, load 15 pl sample for gel electrophoresisb. add 0.8 g agarose and 100 ml ix taeinto a flask, microwave agarose meltsc. insert comb into the mold. position the comb 0.5-1.0 mm

17、above the plated pour the warm agarose solution(65°c ) into the mold, avoid air bubblese. solify the gel under room temperature for 45 min, then carefully remove the combf. place the gel into electrophoresis chamber full with 0.5 x tae/tbeg. load sample 15 u 1 mixture with disposable micropipet

18、te change the micropipette every time. add 4 pl 1 kb dna ladder (50ng/pl) as referenceh. electrophoresis at 100v, stop electrophoresis when the band of bromophenol blue is of 4 strings away from bottom of the geli. place the gel into eb working solution (0.5 g/ml) to stain the gel for 3minj observat

19、ion and photography4 results and discussions4.1 spectrophotometry of dna extractionratio of a260/a230 is relatively high(2.783), suggesting that the analysing by synthesis these two facts, the extraction of dna may contain certain amount of oligonucleotides which can cause a26(>/a28() to be highe

20、r than reference level.4.2 photograph of stained gelafter exposure under uv light, photograph was taken and is shown below.well 1 contains untreated plasmid, 2 bands are present on the lane the fastest and brightest band locates at the length of around 3.0-4.0 kb. because of the fact that plasmid dn

21、a in supercoiled form moves faster in electrophoresis, bright band at 3-4 kb indicates that most of plasmids collected are in their natural supercoiled form. the other dimmer band at around 6 kb suggests that other conformation of the plasmid dna also appears in the extraction( dna with open strand

22、). usually, the dimmer band is brighter than shown in our case.amount of rna is small.3 ladde6.04.03.02.0table 2 : spectrophotometry results of dna extractiona 260a28oa260/a280dna concentration0.4050.2141.904201 ng/ u 1generally the ratio a260/a280 of pure dna is 1.& smaller than the result. mea

23、nwhile, theone possible explanation is that in procedure c of 3.1, pelleted bacterial cells were not resuspended sufficiently, causing a lose of open strand( as well as some supercoiled form dna). this can also exlpain the relatively low concentration of dna(201ng/ m 1).well 2 contains the sample di

24、gested by ecor i alone and single band with the size of approx. 6 kb is presented note that total length of recombined pmcv-myc-sipar is 5.7 kb, the observation of single band near 6 kb suggests a total digestion, which match the expectation of a single incision site.well 3 contains sample digested

25、by ecor i and xho l lane 3 has two bands with length slightly shorter than 4 kb and 2 kb, respectively. the lagging band is brighter than the leading band, which is reasonable since the two bands have the same molecular number.ladder well 200ng dna was added into ladder well, which gives a total mas

26、s of 50ng to 3.0 kb fragment. brightness of leading band in lane 3 is somewhat equal to that of 3.0 kb, suggesting that the sample added contains approximately (50 + 50 * 2 =) 150ng plasmid dna (note that theoretical length of leading band dna is 1.9kb and lagging band is 3.8kb). when this value is

27、doubled (recall that we loaded 15|il out of 30), the experimental mass of plasmid (around 300ng) is, more or less, close to the dna that was added to the mixture( 1.5 u 1 * 201 ng/ u 1 = 302ng).referencea. files of experimental outlines provided by teacher on online.b. zdkwrvbpp_i9bcilbmr40s5zlyit6z

28、5mwaghp715g0aquestions1. difference between preparation of plasmid and genome dna.plasmids are small, supercoiled dna which can be easily renatured by adjusting ph( such as using alkaline lysis) this make the preparation for plasmid easy while genome dna is linear and huge in length and always combi

29、ned with proteins, the preparation is complicated for protein needs to be degraded and the activity of dnase must be low to avoid the degradation of dna itself.2. analysis of african green monkey small polydisperse circular dna junction region， clone pdm-rl by bioedit after installation of bioedit 7

30、.2.5, run the program and create a new alignment (ctrl + n). choose sequence t new sequence, and paste the sequence of african green monkey small polydisperse circular dna junction region, clone pdm-rl from database in genbank. choose sequenee -> nucleic acid t restriction map, default setting is

31、 to detect restriction sites for restriction enzymes that recognize a 6bp fragment.mapping outcome is listed below:bioedit version 7.2.5 (12/11/2013) restriction mapping utility(c)1998, tom hallrestriction map 2014/10/23 1:40:55 100 base pairs translations:nonerestriction enzyme map:aaagcttatccaccca

32、tgatcaagtgggctttatccctgggatgcaaggctccagaatttcatattcagccaaactaagt 801tttcgaataggtgggtactagttcacccgaaatagggaccctacgttccgaggtctta/kagtataagtcggtttgattca 80hindlllbelltaqllbpmibstf5lapo itspdtisfanitspdtieco57minlalvbsajihpyl88iiibsajifoki81ttcataagtgaaggagaaat10081aagtattcacttcctcttta100restriction tab

33、le:enzymerecognitionfrequencypositionsapo ir 1 aatt_y156bellt1gatc_a118bpm ictggagnnnnnnnnnrinnnn_nn 1136bsajic1cnng_g236, 37bstf5iggatg_nn'147eco57mictgragnnnnnnnnnnnnnn_nn1136fokiggatgnnnnnnnnn1nnnn_154hindllla'agct_t13hpyl88iiitc*nn_ga153nlalvggn'ncc151sfanigcatcnnnnn1nnnn_132taqiicac

34、ccannnnnnnnn_nn1128tspdtiatgaannnnnnnnn_nn1250, 72enzymes that cut five or fewer timesenzymerecognitionfrequencypositionsapo ir 1 aatt_y156bellt1gatc_a118bpmlctggagnnnnnnnnnnnnnn_nn1136bsajicf cnng_g236, 37bstf5iggatg_nn'147eco57mictgragnnnnnnnnnnnnnn_nn1136fokiggatgnnnnnnnnn1nnnn_154hindllla

35、9;agct_t13hpyl88iiitc* nn_ga153nlalvggn'ncc151sfanigcatcnnnnn1nnnn_132taqiicacccannnnnnnnn_nn1128tspdtiatgaannnnnnnnn_nn1250, 72positionenzyme(s)3hindllla1agct_t18e ellt!gatc_a28taqiicacccannnnnnnnn_nn132sfanigcatcnnnnn1nnnn_36bpmlctggagnnnnnnnnnnnnnn_nn136eco57mictgragnnnrinnnnrinnnnn_nn 136bsajicf cnng_g37bsajic' crmg_g47bstf5iggatg_nn *50tspdtiatgaannnnnnnnn_nn151nlalvggn'ncc53hpy188iii tcfnn_ga54fokiggatgnnnnnnnnn1nnnn_56apo ir1aatt_y72tspdtiatgaannnnnnnnn_nn1enzymes that do not cut:aarl, aatiif acci