EGFR突变丰度检测.pdf

ORIGINAL PAPER Mutation abundance affects the effi cacy of EGFR tyrosine kinase inhibitor readministration in non small cell lung cancer with acquired resistance Ze Rui Zhao Jin Feng Wang Yong Bin Lin Fang Wang Sha Fu Shu Lin Zhang Xiao Dong Su Long Jiang Yi Gong Zhang Jian Yong Shao Hao Long Received 3 November 2013 Accepted 4 December 2013 Springer Science Business Media New York 2013 AbstractThere is no consensus in the salvage treatment for non small cell lung cancer NSCLC with acquired resistance to primary epidermal growth factor receptor tyrosine kinase inhibitors EGFR TKIs Fifty one consec utive EGFR mutated NSCLC patients with TKI retreatment after acquired resistance were enrolled in this study The quantitation of mutation abundance was performed by real time fl uorescent quantitative PCR The correlation between mutation abundance and outcomes of readministrated TKI was analyzed by survival analysis Patients with high H mutation abundance 24 51 had a signifi cantly log rank P 0 05 longer 5 27 2 53 months median pro gression free survival PFS compared with the low L abundance group 27 51 whereas the median overall survival showed no difference 21 00 18 20 months log rank P 403 between the two groups Objective response and disease control rates in group H and group L regarding the second round TKI treatment were 8 3 70 8 and 0 48 1 respectively Groupings with different mutation abundances were signifi cantly associated with PFS under multivariate Cox proportional hazards regression model hazard ratio HR for group H vs L 0 527 P 036 Mutation abundance affects the effi cacy of EGFR TKIs re administration in NSCLC with acquired resistance The quantitativemutationabundanceofEGFRmaybeapotential predictor for selecting optimal patients to readministrate EGFR TKIs after acquired resistance to primary TKI KeywordsEpidermal growth factor receptor Tyrosine kinase inhibitor Non small cell lung cancer Drug resistance Target therapy Introduction Recently several trials had confi rmed the utility of epi dermal growth factor receptor tyrosine kinase inhibitors EGFR TKIs in metastatic non small cell lung cancer NSCLC 1 2 Unfortunately most patients who initially responded to EGFR TKIs would show a progression dis ease PD within 12 months 3 Successful strategies for conquering such acquired resistance 4 have yet to be Ze Rui Zhao Jin Feng Wang and Yong Bin Lin have contributed equally to this work Electronic supplementary materialThe online version of this article doi 10 1007 s12032 013 0810 6 contains supplementary material which is available to authorized users Z R Zhao Y B Lin X D Su L Jiang Y G Zhang H Long 2 harbored a drug sensitivity associated mutation site e g G719X exon 19 deletion L858R L861Q 3 responded C6 months to initial gefi tinib or erlotinib treatment complete response CR partial response PR or stable disease SD according to the response evaluation criteria in solid tumors RECIST 10 4 PD while on continuous EGFR TKI within the last 30 days Patients were catego rized as non smokers B100 lifetime cigarettes or smokers 100 lifetime cigarettes Patients who had retreated gefi tinib 250 mg d or erl otinib 150 mg d after the fi rst PD were eligible for fi nal analysis Fig 1 cessation of the 2nd EGFR TKIs therapy was permitted only when the patients incurred unbearable toxicity or disease progression according to version 1 1 of the guidelines set out by RECIST Committee 10 Eval uation of treatment response by computer tomography was performed after the fi rst 4 weeks and repeated every 8 weeks Study protocol was approved by the institutional review boards of Sun Yat Sen University Cancer Center Written informed consent was obtained from each patient DNA isolation Genomic DNA was isolated using conventional techniques with QIAamp DNA kit Qiagen Courtaboeuf France Before genomic DNA isolation paraffi n embedded tumor blocks were reviewed for tumor quality and content If the formalin fi xedand paraffi n embedded FFPE tumor Fig 1 Enrollment and outcomes EFGR epidermal growth factor receptor EFGR tyrosine kinase inhibitor TKI cycle threshold Ct real time fl uorescent quantitative PCR qPCR progression disease PD glyceraldehyde 3 phosphate dehydrogenase GAPDH 810Page 2 of 8Med Oncol 2014 31 810 123 blocks were large then the removal of as much non tumor cells and necrotic cells as possible was done to enrich tumor cell percentages By using a hematoxylin and eosin stained slide every micro sampled specimen was cross checked to confi rm that micro dissected areas were not contaminated by non cancerous cells If the FFPE tumor blocks were small like those obtained from needle biopsy this procedure was omitted in order to guarantee suffi cient genomic DNA isolated for qPCR EGFR mutational status detection The methodology of mutation detection has been previ ously described in detail 11 After the extraction of DNA from tumor tissues qualitative detection of mt EGFR was doneusinga fl uorescence based real timedetection method ABI PRISM 7500 Sequence Detection System Taqman Perkin Elmer Applied Biosystems Foster City CA The primers and probe sequences are shown in Table 1 Quantitative detection of mt EGFR wt EGFR After the extraction of DNA from tumor tissues quantita tive detection of mt EGFR wt EGFR and an internal ref erence gene glyceraldehyde 3 phosphate dehydrogenase GAPDH was done using qPCR by using the ABI PRISM 7500 Sequence Detection System Applied Bio systems Foster City CA mt EGFR wt EGFR and GAPDH standards were diluted into a series gradient concentration for standards template 107 106 105 104 103and 102copies ll The primers and probe sequences used are shown in Table 1 The standard curve method was used to determine the number of copies of mt EGFR wt EGFR and GAPDH relative to corresponding gene standards and quantitation was based on standard curves established from a series gradientconcentrationofmt EGFR wt EGFRand GAPDH standards Corresponding number of copies of mt EGFR wt EGFR and GAPDH could be ascertained against a standard curve soon after the values of Ct for mt EGFR wt EGFR and GAPDH were measured All calculations were performed using the ABI PRISM 7500 System Sequence Detection Software Version 1 4 Applied Bio systems Foster City CA mt EGFR abundance calculation Here mt EGFR abundance was defi ned as the percentage of mt EGFR gene in the whole EGFR gene which was borrowed from a concept in chemistry abundance of ele ments Theoretically the calculation equation of mt EGFR abundance is shown as the following Due to non tumor cells and necrotic cells of which EGFR genes were wt EGFR in the samples the mt EGFR abundance calculated using the original number was not accurate Therefore wt EGFR dosage in tumor cells should not be included in non tumor cells Tumor wt EGFR Whole wt EGFR dosage Non tumor wt EGFR dosage In this study the reference GAPDH gene was subtracted from the GAPDH in tumor used to estimate the number of copies of EGFR gene dosage of non tumor cells and necrotic cells in the sample Additionally the GAPDH in mt EGFR cells can be substituted by mt EGFR dosage Thus an approximate non tumor wt EGFR dosage justifi ed by subtracting the incalculable GAPDH wt EGFR can be calculated as follows Non tumor wt EGFR Whole GAPDH GAPDH mt EGFR GAPDH wt EGFR Whole GAPDH mt EGFR dosage Consequently the fi nal calculation equation of mt EGFR abundance can be shown as follows EGFR mutation abundance mt EGFR dosage mt EGFR dosage wt EGFR dosage EGFR mutation abundance mt EGFR dosage 2 mt EGFR dosage wt EGFR dosage whole GAPDH dosage Med Oncol 2014 31 810Page 3 of 8810 123 Statistical analysis Theinitialprogression freesurvival 1stPFS wasdefi nedas the interval between the beginning of EGFR TKI and the progression time Likewise 2nd PFS was defi ned as the period from the start of TKI retreatment to the date at which disease progression or death was noted Overall survival OS was defi ned as the period from the start of TKI re treatment to the date of death Objective response rates ORRs were defi ned as CR PR whole patients disease control rates DCRs were defi ned as CR PR SD whole patients PFS and OS were analyzed by the Kaplan Meiermethod andthelog ranktestwasusedtocomparethe differencewithingroups Thecomparisonindifferentgroups was performed using the v2test or Fisher s exact test as needed Multivariate Cox proportional hazards regression model was used to evaluate independent predictive factors associatedwith2ndPFS Atwo sidedPvalueoflessthan 05 was considered statistically signifi cant All analyses were conducted using PASW statistical software version 18 0 SPSS Inc Chicago IL Results Patients characteristics From May 2003 to September 2011 51 patients were recruited into this study Baseline characteristics were showed in Table 2 Only one patient 2 0 had a rebiopsy after resistance All patients fi nished the second round of EGFR TKIs therapy until a PD was documented EGFR mutation abundance distribution and grouping In consideration of the fold changes of gradient concentra tion for standards template we organized the raw data using a logarithmic transformation Patients were classifi ed into two abundance groups according to previous experience 12 thoseabundanceC0 5015asthehighEGFRabundance group groupH withhighernumberofcopiesofthemutated allele or fraction as opposed to low abundance population and inversely those abundance 0 5015 as the low abun dance group group L given that the corresponding median abundance in this study was 0 5015 and the variable were normally distributed P 006 Consequently objects were divided into two groups as 24 patients 47 1 in group H and 27 patients 52 9 in group L Mutation status and treatment details In total 28 patients 54 9 harbored deletion mutation in exon 19 19 in group H vs 9 in group L and 23 patients 45 1 had a point mutation of L858R in exon 21 5 in group H vs 18 in group L respectively P 002 As for the 2nd EGFR TKI therapy 7 of 51 patients 13 7 had switched TKI regimen all switch from gefi tinib to erloti nib 3 in group L 3 in H and one patient participated in the afatinib clinical trial in group H respectively Table 1 Primers and probe sequences used for detection GeneContentSequences EGFR exon 19Primer 1F 50 CTGGATCCCAGAAGGTGAGAAA 30ab R 50 AGCAGAAACTCACATCGAGGATTT 30ab Probe 1 wild type 50 HEX AAGCAACATCTCCGAAAGCCAACAAGG BHQ1 30a Probe 2 15 bp del 50 FAM TCCCGTCGCTATCAAGACATCTCCGAAA BHQ1 30ab Probe 3 18 bp del 50 HEX TCGCTATCAAGGAATCGAAAGCCAAC BHQ1 30ab EGFR exon 21Primer 2F 50 AACACCGCAGCATGTCAAGA 30ab R 50 CCTTACTTTGCCTCCTTCTGCAT 30ab Probe 4 wild type 50 HEX CAGTTTGGCCAGCCCAAAATCTGTG BHQ1 30a Probe 5 L858R 50 FAM TTTGGCCCGCCCAAAATCTGT BHQ1 30ab Probe 6 L861Q 50 HEX CACCCAGCTGTTTGGCC BHQ1 30ab GAPDHPrimer 3F 50 GGTGGTGAATACCATGTACAAAGCT 30ab R 50 CCAACACCCCCAGTCATACG 30ab Probe 350 HEX AGTGCCCCACATGGCCGCTTC TAMRA 30ab FAM and HEX were reporter group of Taqman probe BHQ1 and TAMRA were quencher group of Taqman probe a Primer and probe used for qualitative detection of mt EGFR b Primer and probe used for quantitative detection of mt EGFR 810Page 4 of 8Med Oncol 2014 31 810 123 No signifi cant association between the length of time a patient responded to the initial TKI and the likelihood that they benefi ted from the readministration independent of high low abundance was found P 643 Additionally we did not fi ndthat such switching would have impacted the outcomes as the 2nd PFS of switched arm vs continuation arm in H 3 93 months 95 CI 2 85 5 01 months vs 4 40 months 95 CI2 73 6 07 months log rank P 824 andinL 4 50 months 95 CI1 19 7 81 months vs 2 53 months 95 CI0 6 04 months log rank P 865 respectively Besides the 3 patients 12 5 one received three lines and two received one line in group H and 6 22 2 two received two lines and four received one line in groupLwhohad received documented post 2nd TKI chemotherapies P 473 the PFS for the rest of them did notdiffer signifi cantly H 6 10 months95 CI 0 13 14 months L 3 93 months 95 CI 0 9 54 months log rank P 372 A chart illustrating the length of treatment on TKI prior to PD other chemo post PD and TKI post PD for each patient was shown Supplementary Fig 1 Effi cacy of the second round TKI The last follow up time was May 2013 and median follow up duration was 42 50 months from the initial TKI therapy range19 77 101 13 months Forty sevenpatients 92 2 exhibited PD and thirty two patients 62 7 Table 2 Patients characteristics TKI tyrosine kinase inhibitor CI confi dence interval CNS central nervous system ECOG Eastern cooperative Oncology Group PR partial response SD stable disease PD progression disease Comparison between the two groups Fisher s exact test used log rank test used Characteristicmt EGFR high abundance mt EGFR low abundance P N N Age years 229 Median63 5061 Range43 7929 76 Gender 095 Female937 51763 0 Male1562 51037 0 Pathology 671 Adenocarcinoma2291 72385 2 Non adenocarcinoma28 3414 8 Smoking status 336 Smoker833 3518 5 Never smoker1666 72281 5 ECOG 195 B12395 82281 5 114 2518 5 Initial TKI response 546 PR937 5725 9 SD1562 52074 1 Progression on initial TKI months 616 Median15 7912 92 95 CI13 06 19 1310 51 24 25 Types of progression 554 CNS progression625 0933 3 Local or non CNS progression1875 01866 7 Time to readministration of TKI after PD months 757 Mean1 211 45 95 CI0 2 530 49 2 41 Chemotherapy before readministration of TKI 508 At least 1 cycle416 7725 9 PFS median6 971 53 667 95 CI0 11 13 830 61 2 45 None2083 32074 1 Med Oncol 2014 31 810Page 5 of 8810 123 17 24 in H vs 15 27 in L P 385 evidenced death in the last date The median 2nd PFS and OS were 3 93 months 95 CI 3 87 6 36 months and 10 17 months 95 CI 11 54 17 90 months respectively Thedifferenceof median 2nd PFS in group H and L was signifi cant H 5 27 months 95 CI 2 36 8 18 monthsvs L 2 53 months 95 CI 0 5 07 months log rank P 033 However no signifi cant results were observed in OS H 16 00 months 95 CI 0 55 31 45 months vs L 14 70 months 95 CI4 80 24 60 months log rank P 033 Table 3 Fig 2 Using grouping based on mutation abundance mutation site smoking history pathological differentiation physical status score brain metastasis in the initial therapy rash condition and PD site for the failure of the 1st TKI as variables themultivariateCoxproportionalhazards regression model showed that only the grouping variable was signifi cantly associated with 2nd PFS hazard ratio HR 0 527 95 CI 290 959 P 036 ORRs and DCRs tend to be higher in group H than in group L 8 3 and 70 8 vs 0 and 48 1 though the differences were not statistically signifi cant P 216 and 154 respectively The most common adverse event was grade 1 or 2 rash which affected 10 patients 19 6 whereas no grade 3 skin rash was observed Besides no dose reduction or discontinuation of TKI due to unbearable TKI associated toxicity was required Discussion To the best of our knowledge this article represents the fi rst demonstration of how EGFR mutation abundance might indicate the extent of effi cacy for TKI readminis tration after acquired resistance of EGFR TKIs Our results Table 3 Effi cacy of readministrated TKI Effi cacymt EGFR high abundance mt EGFR low abundance P N N PFS months 033 Median5 272 53 95 CI2 36 8 180 5 07 OS months 403 Median21 0018 20 95 CI5 97 36 0314 70 21 70 Best response 098 PR28 300 SD1562 51348 1 PD729 21451 9 ORRs28 300 216 DCRs1770 81348 1 154 TKI tyrosine kinase inhibitor CI confi dence interval PFS progression free survival OS overall survival PR partial response SD stable disease PD progression disease ORR objective response rate DCR disease control rate a Comparison between the two groups b Fisher s exact test used Fig 2 a Progression free survival PFS and b overall survival OS of patients in the two groups Group H high EGFR abundance group Group L low EGFR abundance group CI confi dence interval 810Page 6 of 8Med Oncol 2014 31 810 123 show that a potential method in genomic level could be used to select patients with higher mt EGFR abundance as candidates for receiving EGFR TKI retreatment Salvage treatment for acquired resistance to EGFR TKI in patients harboring EGFR mutation with NSCLC remains controversial even though a set of plausible mechanism to resistance has been reported 13 Theoretically several options to overcome EGFR TKI resistance are exist re administration of TKIs second generation TKIs e g afatinib or dacomitinib anti EGFR combinations e g EGFR TKI combined with anti EGFR antibody or anti PD1 immunotherapy Recent retrospective report showed that retreatment of TKI might be useful for ex responders following a drug holiday 14 Therefore it is postulated that a certain proportion of oncogene addicted cells might still remain even when a resistance was notifi ed Several studies 8 15 16 reported the clinical outcomes of a readministrated EGFR TKIs after the primary resis tance and the PFS and OS of these trials varied from 2 0 to 3 4 months and 11 4 to 12 0 months respectively Though these differences may be partly explained by the various enrolled criteria among trials e g patients with clinical benefi t 6 months of initial EGFR TKIs were enrolled in Koizumi s 15 study but 3 months in Oh s 8 trial a signifi cant and better response to TKI retreatment was observed in those who had a PFS more than 6 months during the initial TKI treatment 9 Therefore we acknowledge the acquired resistance criteria introduced by Jackman 4 as a reasonable rational to select patients for the readministration of TKI in the current study Formation of tumor cells is supposed to generate mono clone to multi clones as a result of clonal evolution and genetic epigenetic instability 17 As for the EGFR het erogeneity in lung cancer recent reports by microdissec tion methods have indicated that tumors are composed of mixed populations of mt EGFR and wt EGFR cells and patients with greater EGFR mutation frequency showed longer PFS 6 7 suggesting that the intratumoral heter ogeneity does indeed exist Besides Zhou et