生物信息学课件英文原版课件

Transcript analysis and reconstructionBrazil 2001,Genes,Why are there only a few tens of thousands of genes in the human genome?How do genes express themselves to manufacture the proteome?How can available sequence information be processed in order to deliver understanding of gene expression?,Genomic expression,Within eukaryotes, genes have shared basic characteristics. They have single or multiple exons and introns distributed along the gene in coding and non-coding regions with5 Flanking region with transcription regulation signalsTranscription initiation start site (5)Initiation codon for protein coding sequenceExon-intron boundaries with splice site signals at the boundariesTermination codon for protein coding sequence3 signals for regulation and polyadenylation,GCbox,CAAT,TATA,GCbox,Transcription Initiation Site,Exon 1,Initiation Codon,GT,Transcription Initiation Site,AG,GT,Intron 1,Intron 2,Exon 2,GCbox,GCbox,CAAT,TATA,Transcription Initiation,Exon 1,Initiation Codon,GT,AG,GT,AG,Intron 1,Intron 2,Exon 2,Exon 3,Stop Codon,AATAA,Poly (A) addition site,5 Flanking region,Pre-mRNA,Mature mRNA,Gene Expression,Transcription products can vary.Transcription initiation at the start site (TSS)Exon lengthExon prescence/absence in the mature transcriptAlternate transcription termination and polyadenylation,Alternative donor and acceptor splice sites,Alternative polyadenylation,Exon skipping,Examples of alternative splicing,GCbox,GCbox,CAAT,TATA,Transcription Initiation,Exon 1,Initiation Codon,GT,AG,Intron 1,Exon 3,Stop Codon,AATAA,Poly (A) addition site (s),Exon 2 SKIP,3 Flanking region,Pre-mRNA,Mature mRNA,Capturing expressed transcripts,Databases- SequencesdbESTSeveral collapsed datasetsTIGR-THCAllgenesUnigeneBodyMapSTACKSeveral more specialisedGenome Sequence as it appears:,Expression Capture,Serial Analysis of Gene ExpressionDNA fragments that act as unique markers of gene transcripts. Assay of numbers of each marker in a set of sequence yields a measure of gene expressionArrayLaydown of sequence clones to provide an organised series for hybridisation,Resolution of Captured Expression,ESTSLow resolution, broad capture, provides template for SAGE and ArraySAGEMedium resolution, need template, noise can be an issue, stoichiometry is revealed but standardisation a problemARRAYHigh resolution, need template, noise, stoichiometric resolution highest, standardisation a problem.,3,5,AAAAA,Partial cDNATranscripts,3EST,5EST,Clone/Seq vector with CLONEID,Forwards andreverse sequencingprimers,3 overlapping,5 staggered lengthdue to polymerase processitivity,What is an EST?,What potential do ESTs hold?,Expression countsConsensus sequencesAlternate expression-form characterisationIdentification of genes expressed in a pilot gene discovery projectIdentification of genes specifically expressed in a chosen library or tissue,Use of Transcripts in Completed genomes,Identification of genesExon boundariesAlternate transcriptsGenomic annotationExpression sites of encoded genesComparitive genomics,EST data quality,T27784 g609882 | T27784 CLONE_LIB: Human Endothelial cells. LEN: 337 b.p. FILE gbest3.seq 5-PRIME DEFN: EST16067 Homo sapiens cDNA 5 end AAGACCCCCGTCTCTTTAAAAATATATATATTTTAAATATACTTAAATATATATTTCTAATATCTTTAAATATATATATATATTTNAAAGACCAATTTATGGGAGANTTGCACACAGATGTGAAATGAATGTAATCTAATAGANGCCTAATCAGCCCACCATGTTCTCCACTGAAAAATCCTCTTTCTTTGGGGTTTTTCTTTCTTTCTTTTTTGATTTTGCACTGGACGGTGACGTCAGCCATGTACAGGATCCACAGGGGTGGTGTCAAATGCTATTGAAATTNTGTTGAATTGTATACTTTTTCACTTTTTGATAATTAACCATGTAAAAAATG,EST is Poor Quality data with contaminants,VectorRepeat MASK,Individual items are prone to error but an entire collection contains valuable genetic information,Overview of clustering and consensus generation,Pre-pocessing,InitialClustering,Assembly,AlignmentProcessing,ClusterJoining,Output,RepeatsVectorMask,Alignments,Consensi,Expressed Forms,Transcript reconstruction,What is an EST cluster?,Loose and stringent clustering,Stringent - greater fidelity, lower coverageOne passShorter consensiLower inclusion rate of expression-formsLoose - lower fidelity, higher coverageMulti-passLonger consensus sequences but paralogs need attentionComprehensive inclusion of expression-forms,Supervised clustering,Template for hybridisation is a transcript composite derived from:A captured full length mRNAA composite exon construct from a genomic sequenceAn assembled EST cluster consensus,Clean Short and Tight,TIGR-THC,UniGene,STACK,Long and Loose,Data apprehension and input format.,Sources: In-House, Public, ProprietaryAccession / Sequence-run IDLocation/orientationSource CloneSource library and conditions,Pre-processing,Minimum informative lengthLow complexity regionsRemoval of common contaminantsVector, Repeats, Mitochondrial, XenocontaminantsXBLAST,Repeatmasker, VecBase and othersBLIND maskingPre-clustering vs known transcripts (data reduction),Initial clustering,Stepwise clustering Multistate.sequence identityannotationverification,Assembly,Including chromatograms - SNPs and ParalogsPHRAP and CAP seriesMultiple assemblies can fragment from one input clusterfidelityalt. formserror,Alignment processing,Consensus generationAlternate formsErrorsChoosing the correct consensus,Cluster joining,Clone joiningChoosing to accept a clone annotation1 clone ID2 clone IDsAvailable parentsmRNA (incomplete/alternate)Composite(constructed from Genomic)intronic sequence 2%,Output,Alignment alternate expression-forms polymorphisms error assessmentCluster raw cluster membershipcontextual linksFormats: FASTA, GenBank, EMBL,Alignment scoring methods:,Correct position of sequence elements against each other maximizes some scoreBLAST and FASTA Heuristiccutoff and identitypairwise alignmentfast,EST clustering methods,Est sequence is littered with errors, stutters, in-dels and re-arrangementsalignment approach is sensitive to these3 only comparison,Non-alignment based scoring methods: D2-cluster,No alignment so a speedupSensitivity improved by multiplicity measurelow weight to low complexityvery error toleranttransitive closure96% ID over 100 or 150 bases.,Word table,acggtc cggtca,Multiplicity comparison,3,3,2,(d)2= 4,TIGR_ASSEMBLER,THC_BUILD: BLAST-FASTA id all overlaps and are stored.Tigr-assembler then uses rapid oligo nucleotide comparison and assembles non-repeat overlaps. (95% ID over 40bp)matching constraints on sequence endsminimum sequence id within a sequence group - more fragmented as a resultOther TIGR approaches are similar,UniGene,Unigene approach,Originally 3 only + mRNA common words of length 13 separated by no more than 2 bases.IDAnnotationShared clone IDGenbank, genomic ad dbEST DUST 100bp min MEGABLAST,Wagner et al. CSH 1999,Fragmentation Comparison,Alignment Analysis,Three subassemblies,Potential alternateexpression form,Orthologs and Paralogs,OrthologsGenes that share the same ancestral gene that perform the same biological function in different species but have diverged in sequence makeup due to selective evolutionParalogsGenes within the same genome that share an ancestral gene that perform diverse biological functions.,Needs,Functional assignmentsExpression states of alternate forms and their sites of expressionExon level resolution of expressionRepresentative forms for application to arraysPhysical gene locationsRelationship to disease,Exploration,Availability of genomic sequence and partial transcription products means characterisation of alternate transcription can begin in earnest.Contribution to variation of expressed products and effects on biology are likely to be significant,How to trap useful genome sequence to manufacture a genome virtually?,Gene level approachTrap Expressed Sequence Tags1.8 M tags, 35-100K genesCombine to form virtual genesAnnotate and analyse these genesCorrelate with phenotype(s) = diseaseUnderstand the expression basis of disease,Reconstruction of transcripts,Derive understanding of expressed gene productsUse of expressed sequence data requires complex processingProcessed datasets are badly neededCapture a first glimpse of a genomes activitesGenomic level sequence is the final state, but its products can provide powerful information very early.Characterize underlying gene structureExon boundaries are difficult to define accurately and consistentlyAssess effect of an intervention on gene expression productsA rough EST profile is a quick identifier of key expression productsAssociate isoforms with expression states Expression forms vary, how and when? What does a full length cDNA really mean?,Why is transcript data a problem?,Transcript Data,Full length cDNAGenBank has many entries that confuse full length with complete Coding SequencePartial cDNARedundant partial cDNA sequencesExon CompositeAll confirmed exons combined to form a complete transcriptExpressed Sequence TagSingle pass sequenceGenome Survey SequenceSingle pass sequence Small genomes contain more coding sequences in GSS than larger genomes,Genome Sequence:Characterizing underlying gene structure,Fanfare fragmentFirst Pass AnnotatedExon boundariesPredictedCross species conservationTranscript confirmationComposite exon transcriptHow do you define a transcript?,STACKing approach,Distill quality from quantityAccurate consensus sequence representationIdentify expression variation, both spatial and developmentalFacilitate better understanding of gene expressionExon-level gene expression profileIntegration of expression with genome sequenceConfirm and discover expressed exonsProvide gene candidacy deliveryIntegrate with phenotype,STACKPACK,- C+, MySQL, HTML, Java,stackPACK Schema,ALL alternate expression forms are saved and accessible.,WebProbe - View by clonelink accession,Entering a project name and cluster accession number displays the clonelink Consensus View.,Clonelink cluster ID,Cluster ID,Contig ID,Input EST accession numbers,Link to corresponding UniGene entry,Alignment and Analysis,PHRAP Alignmentfirst alignment createdall ESTs in one alignmentAlignment AnalysisCRAW used to look for subassembliesIdentifies potential alternate expression formsCRAW AlignmentFinal alignment for each subassemblyConsensus AnalysisStatistics used to select best consensusNotes degree of matching between EST & consensus,The Value of Cluster Data,Microarray StudiesClusters represent unique forms associated with a specific stateGene DiscoveryUnique transcripts revealed in association with expression libraries especially in little studied organismsFunctional AnnotationVirtual genes can be searched against the database to provide functional annotation of the products of a genomeExpressed Gene StructureExons boundaries are revealed by transcript confirmation,How to trap useful genome sequence to manufacture a genome virtually?,Gene level approachTrap Expressed Sequence TagsCombine to reconstruct virtual genesMaufacture a substrate for microarray studiesAnnotate and analyse these genesCompare between speciesSpecies-specific characteristicsReveal genes under selection,Raw ESTs,Clusters,Alignments,Consensi,Joined Consensi,predict CDS,Protein Fragments,NNNNN,Virtual ProteinSequence and transcriptreconstruction,Detection of virulence genes in malarial pathogensRahlston Muller,Reconstruction of transcripts from gene expression projects in t