分子大实验-乃哥麦提-2011012325

Comprehensive experiments of Biochemistry and Molecular BiologyMolecular Part生13 杨林枫 2011012326 同组人员：乃哥麦提 褚培睿I. Objectives1. Learn to design an entire molecular biology experiment to get a system which can express protein.2. Review the molecular biology experiment technology we learned before.3. Prepare the samples for part II and part III.4. Organizing each assay to get fully use of the time.5. Corporate with others.II. Background1. HSP16.3HSP16.3, a small Heat Shock Protein from M.tuberculosis, consists of 144 amino acids and has a molecular weight of 16277 Da. It is significantly expressed when M.tuberculosis changes from logarithm phase to stable phase and becomes main protein in the cell. HSP16.3 is also an antigen, important target site of T and B cell in immune response. Experiments in vitro indicate that HSP16.3 has a chaperone activity, and it can inhibit thermal aggregation of citric acid synthetase at 39.5 without consumption of ATP. But it cannot protect citric acid synthetase activity, which indicates that HSP16.3 interacts with partially unfolding citric acid synthetase and refolding of protein in vivo may need other proteins. Gel chromatography can separate HSP16.3-citric acid synthetase complex, and SDS-PAGE can identify them. HSP16.3 may expose its hydrophobic surface to carry out its chaperone activity. With mild temperature and mutagen in low concentration, for example, under the condition of 0.05 M Guanidinium chloride, 0.3 M urea and 30, HSP16.3 will expose its hydrophobic surface and elevate its chaperone activity.HSP16.3 is a member of -crystalline associated small Heat Shock Protein (sHSP) family, with the typical conserved CTD: D/N-G-V-L-T-T/V-X-V/A. sHSP have many different biological functions. They all have chaperone activity, interacting with denatured protein substrate even without ATP. Research shows that they often form certain oligomer structure to carry out its function, for example, M.Janneschii HSP16.5 forms 24-oligomeric structure and Triticum aestivum HSP16.9 forms 12-oligomeric structure.HSP16.3 is one of the several sHSP from prokaryotes that have been found. The function mechanism of it is not clear yet.2. PET-28a plasmidLibrary ID: G0306Name: pET-28a(+)Type: BacterialResistance: KanamycinCondition of culture: Grow in standard E. coli at 37Figure 1. pET-28a plasmidThere are modules such as lac operator, which facilitates artificial induction of gene expression, His tag, which facilitates protein purification, and MCS in the vector. 3. Background about PCRThe polymerase chain reaction (PCR) is a technique for amplifying DNA sequences in vitro. This method takes advantage of thermally stable DNA polymerase and can produce numerous copies (about 268,435,456) of DNAs from a single template DNA molecule through tens of repeated cycles of template denaturation, primer annealing and DNA synthesis. It is extremely sensitive to trace contamination of unwanted template DNA in the reaction solution.This method is also important in biotechnology, forensic identification, medicine and genetic research. PCR was invented by Kary Mullis and his colleagues in 1985. The discovery of Taq DNA polymerase, thermally stable enzyme isolated by Chien et al. in 1976, made the PCR automation possible. In 1987, Kary Mullis et al. accomplished the PCR automation system which made PCR practical. Kary Mullis was awarded the 1993 Nobel Prize in Chemistry for inventing PCR. PCR has played a major role in the Human Genome Project. The technique has also become invaluable in biotechnology, medicine, disease diagnosis, forensic-science analysis in convicting the guilty and freeing the falsely accused, and the study of DNA from ancient or fossil tissues. Figure 2. The polymerase chain reaction (PCR)4. Gel ElectrophoresisAfter melted in high temperature, the agarose solution will form solid with certain size of small pores. The size is determined by the agarose concentration. In the electric field and buffer in neutral pH, negatively charged nucleic acid will migrate toward the positive pole. Factors that influence the mobility of DNA in gel electrophoresis: molecular weight of DNA, DNA conformation, voltage, direction of electric field, base pair, insert dye and electrophoresis buffer.The agarose concentration of gel can affect the mobility of linear DNA molecules. Different concentration of agarose is used to separate DNA of different size. Gel with 0.8% agarose concentration can efficiently separate DNA fragments of 1-25kb. Gel with 0.5% agarose concentration is used to separate larger DNA fragments (20-100kb).Smaller DNA fragments of 0.2-2kb can be separated with 1.5% or even higher concentration gel. The gel concentration is determined by the molecular weight of DNA fragments to be separated. (see Figure 3)Figure.3 Gel Electrophoresis5.Recombination of DNA By virtue of the sticky end created by a restriction enzyme, it is possible for us to create DNA recombination fragments. The nature of DNA recombination is a biochemical way of enzymatic reaction. It means that we can insert a DNA fragment of target foreign gene into a plasmid vector by using DNA ligase. The DNA fragment can duplicate just when it recombines with vector and transforms to a suitable host cell. 6.Restriction EndonucleaseRestriction endonuclease plays a key role in the identification and insertion of DNA fragments. Restriction endonucleases recognize specific sequences of nucleotides in DNA molecules and make cuts in both the two strands, generating sticky ends or blunt ends. This allows very specific cutting of DNA. Moreover, because the cuts in the two strands are frequently staggered, restriction enzymes can create sticky ends that help link two DNA fragments together to form a recombinant DNA in vitro. In reality, several factors are capable of affecting the sensitivity and activity of restriction endonucleases, such as the purity of DNA, the degree of methylation of DNA, the temperature of the restriction enzymolysis of DNA, the molecular structure and base pair components of DNA, the type and concentration of irons in the buffer, the PH of the buffer, etc.7.Prepare competent cells from E. coliBy using chemical reagent like CaCl2, it is possible to prepare the competent cell for recombination. The cell membrane changes the permeability, and then it can bear foreign DNA from vector passing the competent cell.8.Transformation of the competent cells（1）Transformation of the competent cells is an important technique of experiment in genetic engineering; it means that we can introduce the heterogenic DNA into a cell line. Then it can make the competent cell own the new hereditary character.（2）The DNA into the cell can transform genetic information and expresses new hereditary character when it duplicates. The competent cell we use is restriction-modification system defect mutant strain; the strain doesnt contain restriction enzyme and methylase.（3）The basic principle of transformationThermal shock: Prepare the competent cells with chemical reagent like CaCl2, the cells are then subjected to thermal shock, then introduce the vector into transformation cells.The electric transformation: Use low concentration buffer or water wash the competent cell, transforming DNA into transformation cells by using pulse of high voltage.Figure 4. Transformation9. Selection of Cloning BodyIt is possible to use different antibiotics to select cloning body due to the anti-antibiotic gene in the plasmids. Among the various antibiotics often used are Ampicillin, Kanamycin, Tetracycline, Chloromycetin, and Streptomycin.III. Material and equipment.1. For PCR Materials:Template DNA (containing the Kanamycin resistance gene, diluted beforehand)Upstream and downstream primers (diluted to 25M beforehand)Upstream primer：5- CA GGATCC GCCACCACCCTTCCCGTTCA -3Downstream primer：5- CCG CTCGAG GTTGGTGGACCGGATCTGAA -3Reagents:10PCR Buffer (Mg2+ plus)dNTP Mixture (2.5 mM each)TaKaRa Taq Polymerase 5U/l2. Restriction enzyme digestion of PCR product and the vectorMaterials:PCR productpET-28a vectorReagents:BamHI(15U/ul)Xhol I(10U/ul)Enzyme digestion bufferEquipment:Water bathPipette and tipsEP tubesIce box3. For PCR product purificationMaterials:Enzyme digested PCR productReagents:100% ethanol70% ethanoldistilled water3M NaAcEquipment:RefrigeratorCentrifugeEP tubesPipette and tips4. For electrophoresisMaterialsDNA sampleNEB 1Kb DNA Ladder (diluted to 50ng/l)aragoseReagents:5 TAE buffer10 loading bufferEBEquipment:Electrophoresis instrumentElectrophoresis troughPipette & tipsMicrowave ovenUltraviolet transmission InstrumentGel Imaging System5. For Purification of the digested vectorMaterialRecovery from Gel - Small Scale DNA Fragment Purification Kit (BioDev): Gel dissolving solution, Con.Wash Solution.EquipmentType B Absorbance Spin Column/ Waste Liquid Collection Tube6. For ligationMaterials:Digested and purified PCR productDigested and purified pET-28a vector(Kanamycin, lacZ), 5.3kbReagents:DNA Ligation Kit Ver 2.1 (TaKaRa)Equipents:Ice box7. For plasmid isolation Materials:Transformed and selected E.coli DH5 cellsReagents and equipment:Small scale plasmid rapid extraction kit (BioDev Corp.)8. For transformation of recombinant plasmidMaterials:Competent cells: E.coli BL21 or DH5 strainRecombinant plasmidReagents:LB culture medium (solid and liquid)Kanamycin solutionEquipents:Shaker flaskCentrifugeWater bathIncubatorClean deskIce boxPipette & tipsEP tubesSelection plateIV. ProceduresThe procedure can be figured as follows:Enzyme digestion of the vector: PET-28aPCR of the template DNA Preparation of the competent cell BL21.Plasmid extraction of the positive clone.Transformation and clone selection of the plasmid to the E.coli.Preparation of the competent cell DH5a.Electrophoresis of the ligation product. Ligation of the vector and gene fragment.Gel electrophoresis of the digestion product.Gel electrophoresis And Recycling of The Vector Digestion.Enzyme digestion of the PCR DNA and gel electrophoresis of the purification product.Purification of the PCR product.Transformation of the plasmid to BL21 and the further incubate of it.Experiment 1. PCR1. Prepare the PCR mixture.Prepare the PCR system mixture as following in EP tube. ReagentQuantityTemplate DNA2l Lower Primer0.5l Upper Primer0.5l dNTPs4l Taq DNA polymerase0.5l10buffer（Mg2+）5lddH2O19.5lTotal50lTable 1. PCR System2. PCR cycleEach cycle comprises the following three steps:1) Denaturation: At high temperature (90-95oC), the double-strand DNA melts and opens into single-strand DNA. 2) Annealing: At low temperature (35-65oC), single-strand primer binds to the single-strand template forming partial double strand. 3) Extension: At 72oC, the DNA polymerase extends the primers by reading the opposing strand sequence and adding nucleotides. The number of target sequences is doubled after each cycle. Experiment 2. Enzyme Digestion of the vector1. Prepare the digestion system as following.ReagentQuantityplasmid10lBamHI2lXholI3l10 Buffer5lddH2O30lTotal50lTable 2. Enzyme Digestion System (Vector)2. Incubate the EP tube at 37 for 3 to 4 hours.Experiment 3. The Purification of PCR Product And Gel Electrophoresis Test1. Use the PCR Clean-Up Kit to attain the solution of target DNA fragment.1) Add 50ml sample (PCR product) to 400ml combining buffer.2) Transfer the mixture into the absorption column and centrifuge at 12,000 rpm for 30 seconds.3) Drop the waste, and then add 500ml washing buffer and centrifuge at 12,000 rpm for 30 seconds.4) Repeat the previous step once.5) Centrifuge at 12,000 rpm for 2 min.6) Make sure the column is free of washing buffer, transfer the column into another clean Eppendorf tube then wash it with 40ml deionized-water7) After a minute at room temperature, centrifuge at 12,000 rpm for 30seconds;8) Collect the product in the Eppendorf tube. 2. Gel Electrophoresis1) Add Bromophenol Blue into the incubated vector digestion product. 2) Load all the solutions in the pore. Run the gel electrophoresis.Experiment 4. Enzyme Digestion of the PCR Product1. Prepare the digestion system as following.ReagentQuantityPCR product6lBamHI1lXholI1l10K Buffer2lddH2O10lTotal20lTable 3. Enzyme Digestion System (PCR)2. Incubate the EP tube at 37 for 1 to 2 hours.Experiment 5. Gel Electrophoresis And Recycling of The Vector Digestion ProductGel Electrophoresis1. Add Bromophenol Blue into the incubated vector digestion product. 2. Load all the solutions in the pore. Run the gel electrophoresis.Recycling1. Cut the fluorescent band off the gel and put it in an EP tube.2. Add 500ml gel melting buffer to the EP tube to resolve the gel.3. Transfer the mixture into the absorption column and centrifuge at 12,000 rpm for 30 seconds.4. Drop the waste, and then add 500ml washing buffer and centrifuge at 12,000 rpm for 30 seconds.5. Repeat the previous step once.6. Centrifuge at 12,000 rpm for 2 min without any buffer.7. Make sure the column is free of washing buffer, transfer the column into another clean Eppendorf tube then wash it with 30ml deionized-water.8. After a minute at room temperature, centrifuge at 12,000 rpm for 2 minutes.9. Collect the product in the Eppendorf tube. n Experiment 6. Enzyme digestion of the PCR DNA and gel electrophoresis of the purification product and vector digestion product.1. Add 3l of the recycled PCR product and recycled vector digestion product respectively in two different lanes.2. Run the gel electrophoresis. Stain the gel with EP. Detect the gel with UV gel imaging instrument.3. Observe the relative brightness for the band of PCR product and the band of vector enzyme digestion product. Calculate the proper loading volume of two during recombination.Experiment 7. Ligation1. Prepare the recombination system in an EP tube as following.Reagent QuantitypET-28a enzyme digestion product(recycled)4lPCR product (recycled)3lSolution 7lTotal14lTable 4. Recombination System2. Incubate the EP tube at 16 for 1 hour.Experiment 8. Transformation And Clone Selection1. Prepare100l of the cooled E. coli DH5cells in an EP tube.2. Pipette the entire recombination product in the EP tube. Mix the solutions gently. keep on ice for 20-30 minutes3. Heat shock by transferring the tubes to a water bath of 42 for 90 seconds. 4. Immediately return the tube to the ice bath. Keep on ice for 2 minutes.5. Add 0.9 ml of LB (with no antibiotics added) into each tube. Incubate the tubes for 45 minutes at 37 to allow the cells to express their antibiotic gene product (Kanamycin). 6. Centrifuge the tube. Discard 350l of the supernatant. Mix the remaining solution to resolve the deposit. 7. Spread 200l of the resulting solution on the LB plates. After complete absorption of liquid LB, upside down the plates and incubate the plates at 37 overnight.Experiment 9. Extracting PlasmidIncubation of Transformed CellsSelect a single colony using a asepsis toothpick. Inoculate it into 3ml LB medium (containing 50ug/ml kanamycin ). Incubate it on a shaker at 37, 180rpm, for 12-16 hours.Extraction of The Recombinant Plasmid1. Pellet 1.5 ml of cells by centrifugation for 12 minutes at 12000rpm. Decant the supernatant. (1.5ml each time and collect about 3 ml culture of E.coli in 1.5ml Eppendorf tube.) Completely resuspend the cell pellet in 100ml solution 1 by vigorous vortex.2. Add 150ml solution 2, mix by inverting the tube 4-6 times gently and incubate the tube on ice for 1-2 minutes. The cell suspension should be clear immediately. 3. Add 150ml solution 3, invert the tube gently several times, place the tube at room temperature for 5minutes, and centrifuge at 12000rpm for at least 5 minutes.4. Add 420ml binding buffer to the mini-spin column. Then transfer the supernatant of procedure c to the same mini-spin column. Mix the supernatant and binding buffer with pipette carefully. Then place the column in another tube, centrifuge at 12000rpm for 30 seconds and then discard waste liquid in the tube.5. Add 750ml wash buffer to the column, and centrifuge at 12000rpm for 30 seconds.Repeat procedure e. Then centrifuge at 12000rpm for 2minutes. Eliminate wash buffer as thoroughly as possible. The ethanol in wash buffer will impact the following enzyme-catalyzed reactions.6. Carefully move the column into another clean tube. Add 50ml water into the column, place it at room temperature for 1-2 minutes, and centrifuge at 12000rpm for 2 minute.Experiment 10. Identification of The ColoniesEnzymatic Digestion of The Recombinant Plasmid1. Add to an Eppendorf tube: Reagent Quantitypurified recombinant plasmid8l10X K buffer 2lXholI1lBamHI1lSterile ddwater8lTotal20lTable 5. Enzyme Digestion System2. Incubate the EP tube at 16 for 1 hour.3. Electrophoresis1) Sample loading. ReagentQuantityDigested recombinant plasmid3l10loading buffer1lTotal4lTable 6. Electrophoresis System2) Start electrophoresis immediately after samples loading. Electrophoresis at 80100V3) Place the gel into EP working solution (0.5mg/ml) to stain the gel for about 5min4) Observation under UV,Experiment 11. Transformation and Clone SelectionTransforming Prepare100l of the cooled E. coli DH5cells in an EP tube.1. Pipette the entire recombination product in the EP tube. Mix the s