分子遗传学课件Protein translation for mol med genetics final part1

1、分子遗传学课件Protein translation for mol med genetics final part1“the student is in danger of spending too much of his limited time memorizing facts, and has insufficient time at his disposal to master the principles underlying his subject and to develop his powers of thought”. It continues: “the most imp

2、ortant purpose of a university education is to teach the student to think for himself . it may on occasion demand a re-examination of the whole approach to a subject in undergraduate courses.” Barry S. Winkler Eye Research Institute, Oakland University, Rochester, Michigan, USA. Na

3、ture 523, 282284; 2015Nature 205, 835; 1965 “Follow your interests and work with people who inspire you, is the best advice I can offer.”Prof. Daniel J. KlionskyUniversity of MichiganTextbookDNARNAProteinCentral Dogma1968 Robert W. Holley, Har Bobind Khorana, Marshall W. Nirenberg “For their interpa

4、retation of the genetic code and its function in protein synthesis”UCUCUCU UCU CUC UCUUCU-SerineCUC-LeucineThe 2009 chemistry Nobel Prize has been awarded to Venkatraman Ramakrishnan, Thomas Steitz and Ada YonathN AT U R E | VO L 4 9 7 | 2 MAY 2 0 1 3 PART I: Protein Synthesis Components PART II: Pr

5、otein Synthesis Process PART III: Protein Synthesis Regulation PART IV: Posttranslational Processing and Targeting PART V: Protein Synthesis in MedicinePART I: Protein Synthesis ComponentsThe components of translation 1. mRNAs (the genetic code)2. Aminoacylated tRNAs3. Ribosomes 4. Protein factors (

6、and energy)Prokaryote: polycistronEukaryote: monocistronUntranslated RegionRibosome binding siteInitiation codonTermination codonCoding region53Protein3Protein5Cap structure1. mRNAs (the genetic code)Eukaryotic mRNAs have same general features as bacterial mRNAs but .1. Special “cap” with a 5-5 link

7、age between a modified guanosine nucleotide and the first nucleotide of the transcript (post-transcriptional)2. poly(A) tail - 50 to 200 adenosines (post-transcriptional)7-methylguanylate cap What is the relationship between mRNA and the amino acid sequences? RNA A/C/U/GProtein20 Amino acids?The mat

8、h:4 x 4 = 164 x 4 x 4 = 644 x 4 x 4 x4 = 256. The Genetic CodeWhat do we need in a code?startsstopsall triplets code for somethingnice to have single nt changes be rather conservative-the substrates of translation represent the process of translation - phenotype at one end (CCA) and genotype at the

9、other (anticodon)-the acceptor end carries a universally conserved CCA sequence that is essential for interactions with elongation factor EF-Tu and the ribosomal tRNA binding sites (A, P and E); the appropriate amino acid is attached by the aminoacyl tRNA synthetase; this end of the tRNA interacts w

10、ith the large subunit (50S) of the ribosome where peptide bond formation occurs-the anticodon end of the tRNA is responsible for the codon:anticodon interaction that results in high fidelity protein synthesis; this interaction takes place on the small subunit (30S/40S) of the ribosomeFeatures of the

11、 Genetic CodeA. ColinearlThe sequence of codons is read from 5 to 3 lPolypeptide from amino end to carboxyl endmRNAPolypeptide The genetic codons should be read continuously without spacing or overlapping. B. Commalessspacingoverlappingl If there are insertion or deletion of one or two nucleotide(s)

12、 in the coding region of mRNA, frameshift mutations occur. insertiondeletionC. Degenerate目 录l Multiple codons may decode the same amino acidl Most amino acids have more than one codons except Met and Trpdegeneracy目 录Amino acidAmino acidCodon numberCodon numberD. Universal The genetic codons are larg

13、ely universal except for the mitochondria Cytoplasm AUA: Ile AUG: Met, initiation UAA, UAG, UGA: termination Mitochondria AUA: Met, initiation UGA: Trp AGA, AGG: termination E. Wobble Non-Watson-Crick base pairing is permissible between the third nucleotide of the codon on mRNA and the first nucleot

14、ide of the anti-codon on tRNA. How does wobble pairing allow for the degeneracy of the code?So, if perfect matches between the anticodon and codon were required, then there would be 61 tRNAs in each organism but there are usually 30-40 tRNA speciesBase-pair of codon and anticodonFirst step in decodi

15、ng is to get the right amino acid on the right tRNA (this is fundamentally the deciphering of the code)-ca. 20 synthetases (for 20 amino acids) (RS)Two-step mechanism:Activation step: RS + aa + ATP - RS (aa-AMP) + PPiTransfer step: RS (aa-AMP) + tRNA - RS + AMP + aa-tRNAPyrophosphate hydrolysis: PPi

16、 + H2O - 2Pi- aa + ATP +tRNA +H2O - aa-tRNA + AMP + 2Pi2. Aminoacylated tRNAs1st step:Amino acidATP-E aminoacyl-AMP-E PPi目 录Amino acidAminoacyl-AMPAACarboxlyPhosphate2nd step:aminoacyl-AMP-E tRNA aminoacyl-tRNA AMP E目 录AAAAminoacyl-AMPaminoacyl-tRNA synthetaseAminoacyl-tRNA （AA-tRNA） Aminoacyl-tRNA

17、synthetases catlyze specific amino acids and tRNAs (20 types). aminoacyl-tRNA synthetase has proof-reading activity (editing activity) ; error rate 1/40,000 aminoacyl-tRNA (AA-tRNA)：Lys-tRNALysMet-tRNAMet Active formaminoacyltRNAActivation sitea a - carboxyl groupLinkageester bondActivation energy2

18、high-energy bondsSummary of AA activationHow do the synthetases achieve high levels of fidelity?-how are very similar overall tRNAs distinguishedWhat about amino acids?-large amino acids are readily excluded from binding pockets(e.g. tryptophan excluded from alanineRS)-but there is also a hydrolytic

19、 site (“proofreading”) on the enzyme where inappropriately charged tRNAs are selectively deacylated (pocket not filled and external water can come in)(e.g. glycine gets loaded by alanineRS)Charging tRNA:1. amino acid + ATP aminoacyl-AMP + Ppi2. aminoacyl-AMP + tRNA aminoacyl-tRNA + AMPN-acetylation

20、of aminoacyl-tRNA:Acetic anhydride used to acetylate aminoacyl-tRNA3. The ribosome-the mass of the bacterial ribosome is ca. 2.5 million daltons and its dimensions are about 200 per side (compared to tRNA at ca. 60 lengths)-two subunits perform two basic functions of translation - how are these acti

21、vities integrated across the subunit interface Aminoacyl site(A site)Large and small subunitsAccepting an aminoacyl-tRNAPeptidyl site(P site)Large and small subunitsForming the peptidyl bondsExit site (E site) Large subunitReleasing the deacylated tRNAlocationfunctionThree important sites on ribosom

22、esRibosomes (the translation machine)-more than 80% of cellular RNA; sediment at “70S” in sucrose gradient; two-thirds of the mass of a ribosome is RNA and its sequence is highly conserved (drug target)-all ribosomes are composed of two subunits; a large subunit and a small subunit that interact wit

23、h the acceptor and anticodon end of the tRNA, respectivelyStructure of 40s and 60s ribosomal subunitsTernary complexStructure of 80sLocation of initiation complex on ribsomeStructures of translation related components in database -ribosome conservation is remarkable; there are reports of functional

24、interactions (i.e. translation) between the small subunit of a eukaryote Artemia salina (sea monkeys) and the large subunit of the eubacteria E. coli-certain regions of the rRNA are universally conserved across all three phylogenetic kingdoms including the sarcin-ricin loop of 23S rRNA,the P and A l

25、oops of 23S rRNA, the central PT loop of 23S rRNA, the 530 loop and the decoding region of 16S rRNA - not surprisingly these are all regions that are fundamental to the various functions of the ribosomeRibosome conservationAnother “ “component” ” of translation the protein factors-a number of protei

26、n factors are involved in all steps of protein synthesisIFs are involved in initiationEFs are involved in elongationRFs are involved in terminationBacterialEukaryoticInitiationIF1eIF1AIF2eIF5BIF3eIF1 (fidelity of AUG)eIF2 (tRNAMet)eIF4E (cap)eIF4G (scaffold)eIF4A (helicase)eIF4B (RNA binding)eIF3 (u

27、nknown/ large)eIF5 (GAP for eIF2)PABPElongationEF-TueEF-1aEF-GeEF2EF-TseEF-1bTerminationRF1eRF1 (Release)RF2RF3eRF3RecyclingRRF?Eukaryotic core initiation factorsCurrent Opinion in Structural Biology 2012, 22:768777PART II: Protein Synthesis ProcessThe translational cycle 1. Initiation 2. Elongation

28、 3. Termination2.1 Formation of Initiation ComplexIn the initiation stage, ribosome, initiation aminoacyl-tRNA and mRNA molecules are assembled to the translational initiation complex For prokaryotes: fMet-tRNAimet can only be recognized by initiation codon. Met-tRNAemet is used for elongation. For

29、eukaryotes: Met-tRNAmet is used for both initiation and elongation. Initiation tRNA Prokaryotic Met-tRNAmet can be formylated to fMet-tRNAimet. Prokaryotic Met-tRNAmetMet-tRNAmet + N10-formyl tetrahydrofolate (四氢叶酸四氢叶酸)fMet-tRNAimet + tetrahydrofolateformyl Transferase甲酰转移酶甲酰转移酶Translational initiat

30、ion factors in prokaryote IF-3 is needed for 30S subunits to bind specifically to initiation sites in mRNA. IF-2 binds a special initiator tRNA and controls its entry into the ribosome. IF-1 binds to 30S subunits only as a part of the complete initiation complex, and could be involved in stabilizing

31、 it, rather than in recognizing any specific component. The forming of translational initiation complex in prokaryoteInitiation factors IF-1 and IF-3 bind to the free 30s subunit ；mRNA bind to ribosome 30s subunit；With the help of IF-2 and GTP, the initiator fMet- tRNA can bind to the initiation cod

32、on ( AUG ) on the mRNA； The 50S subunit binds, displacing IF1, IF2 and IF3. The 70S initiation complex is formed.Initiation (in eukaryotes) - cap and polyA tail are critical for message quality control and translation regulationHow to get the 40S subunit on the mRNA with the Met-tRNAi engaged in the

33、 P site with the AUG start site - i.e. the same problem-a complex of proteins assembles at the cap structure, these proteins then interact with the polyA tail (and associated PABP) to form the closed loop complex ready for translationGeneral observation: synergistic effects on translation by the 5 c

34、ap and 3 polyA structures - disruption of the 4G-4E or the 4G-PAB interactions substantially diminish translationeIF4 Factors Are Required for Cap-dependent Translation InitiationeIF4EeIF4GeIF4A eIF4BeIF3eIF5eIF2GTPMeteIF140SeIF1Am7GpppGAUUCGAUACCAGGGAGCUUGGCACCAUGGCPABPPABPAAAAAAAAAWells et al. Mol

35、. Cell 2, 135-40. Circularization of mRNA by Eukaryotic Translation Initiation Factors.Atomic force microscopy2.2 Translation InitiationProkaryoticsEukaryoticsIF-3IF-1IF-1 and IF-3 bind to a free 30S subunit 目 录Translation initiation in ProkaryoticsA U G53IF-3IF-1mRNA binds to 30S subunit 目 录S-D seq

36、uence（Shine-Dalgarno sequence）,also called（ribosomal binding site, RBS） 8-13 nt upstream of the initiation codon in prokaryotic mRNA which base-pairs with a complementary sequence near the 3 end of 16SrRNA. S-D sequence rpS-1 recognizing sequence16S-rRNA in ribosome small unitIF-3IF-1IF-2GTPfMet-tRN

37、A bind to the initiation codon of mRNA A U G53目 录IF-3IF-1IF-2GTP50S ribosomal subunit incorporate into complexA U G53目 录Translation initiation in EukaryoticseIF4EeIF4GeIF4A eIF4BeIF3eIF5eIF2GTPMeteIF140SeIF1Am7GpppGAUUCGAUACCAGGGAGCUUGGCACCAUGGCPABPPABPAAAAAAAAAActivation of mRNAEukaryotic Translati

38、on InitiationIRES Driven Translation InitiationIRES:Internal ribosome entry siteExisted in: virus(EMCV:脑心肌炎；HCV：丙肝病毒；CrPV:蟋蟀麻痹病毒） some cellular mRNA(c-Myc; p53; XIAP)eIF4 Factors Are Not Required for HCV IRES Translation InitiationeIF3eIF5eIF2GTPMeteIF140SeIF1APABPPABPAAAAAAAAA 2.3 Elongation Three

39、steps in each cycle: Positioning an aminoacyl-tRNA (AA-tRNA) in the A site- Entrance Forming a peptide bond-Peptide bond formation Translocating the ribosome to the next codon-Translocation Elongation is a process of repeated ribosomal cycles of amino acid addition. Polypeptides grow stepwise from t

40、he amino terminus to the carboxyl terminus.Elongation factors (EFs) are requiredProkaryote：EF-Tu, EF-Ts and EF-GEukaryote： eEF-1 , eEF-1 and EF-2 Step 1: Entrance An AA-tRNA occupies the empty A site. Registration of the AA-tRNA consume one GTP. The entrance of AA-tRNA needs to activate EF-T.TuTsGTP

41、GDPA U G53TuTsStep 2: Peptide bond formation The peptide bond formation occurs at the A site. The formylmethionyl group is transferred to NH2 of the AA-tRNA at the A site by a peptidyl transferase The 23SrRNA ( in eukaryotic ribosome the 28SrRNA ) catalyzes the peptide bond formation: ribozymePeptid

42、e bond formation 1Peptide bond formation 2Step 3: Translocation EF-G is a translocase. GTP bound EF-G provides the energy to move the ribosome one codon toward the 3 end on mRNA. After the translocation, the uncharged tRNA is released from the E site. Translocation fMetA U G53fMetTu GTPIntermediates

43、 of the small subunit during mRNA and tRNA translocationDecoding center of eubacterial 70s ribosomeAPEAPEAPEAPEAPEAPEAPEStep 1. Loading tRNA and Coden Recognition by eEF1Step 2. Peptidyl TransferStep 3. Translocation by eEF2eEF1A, eEF2, GTP, ribosomes, polyU RNA, tRNA-Phe 2.4 TerminationRelease factorsProkary