DNAWorks全基因合成介绍

1、gene synthesis using dnaworksdr. david hooverhelix systems, scb, cit, nihgene synthesisseveral methods ligation - incredibly tedious and inefficient foki - sequence dependent (type iis r.e.) serial cloning - sequence dependent assembly or self-priming pcrgene synthesis methodsthermodynamically balan

2、ced conventionalthermodynamically balanced inside-outprotein expressionprotein/structure independent factors: promoters and upstream elements translational initiation and termination mrna stability codon biasprotein/structure dependent factors: folding and aggregation proteolysis and degradation sec

3、retion and localizationcodon bias0.0%10.0%20.0%30.0%40.0%50.0%60.0%70.0%80.0%90.0%r:aggr:agai:atag:ggap:cccr:cgal:ctar:cggt:acal:ttas:agts:tcal:ctgs:tcgr:cgcr:cgta:gcgp:ccge. colih. sapienssynthetic genesbenefits: codon use optimized for host flexibility in subcloning ease of complex mutagenesisprob

4、lems: time consuming complicated error-pronecommercial sourcesblue heron biotechnology (http:/)dna 2.0 (http:/ script corporation (http:/ inc. (http:/ (http:/ (http:/ devices (http:/ sourcestypical costs: $0.79 - $3.60 / bp complexities? intellectual property? 800 bp = $1000 (gene script)genes from

5、scratch oligos $0.20 / nt (nih discount) pcr reagents $2 / reaction sequencing $20 / 600 bp electrophoresis $3 / gel labor $20 / hrgfp, 238 aa, 714 bp, 20 oligos, 1134 nt, 2 reactions, 2 gels, 4 sequences, 10 hrs = $517how to design oligosreverse-translate protein into dna, optimum codon usagebreak

6、into fragments of equal overlap tmoptimize: hairpins / mrna structure repeats / mispriming restriction site inclusion / exclusion lengthdnaworks/dnaworks/dnaworks output 181 tctggtgaaggcgagggtgacgcgacctacggtaaactcactctcaaat agaccact tgccatttgagtgagagtttaagtagacgtgg 241 ggttcctt

7、ggccgaccctggttactaccttctcttacggtgttcag tgcccgtttgacggccaaggaaccggctgg tc 12 nt (short) tm range should not be 3c (tmrange)dont depend entirely on scores arbitrary, somewhat dependent on lengthtrickschoosing codons random - slower optimization, less constrained strict - for the fussy scored - if codo

8、n score really matterstm, length ranges, number of solutions to find the very best solution no more than 999tricksdesign multi-use and interchangeable oligos flanking primers with standard overlaps intersperse nucleotide elements between protein elements gap-fix restriction sites allow for mutations

9、 later onrandom mutagenesis nucleotide sequences can be degeneratetricksthermodynamically balanced inside-out mode multi-step pcr more controlled, reliable method gao x., et al., nucleic acids res 2003random oligo lengths faster, better optimization for the not-so-fussy probably best for dna-only ge

10、nestricksset tm higher 64c - 70c longer oligos, extra purification ($)always double check!nothing is foolproof think carefully about what you need before starting work always run final sequences through alternate program (emboss, gcg-lite) make sure oligos are what you intendedpcr mix all oligos and

11、 additives specific pcr protocols analytical gel isolate desired productsassembly protocololigos 1 l625 nm each25 nm eachdntps 2 l 2.5 mm each0.25 mm eachh2o19 lbuffer2.5 l10x1xpfu pol.0.5 l95c2.0 1x95c0.5 6555(-0.5)0.5 20x72c0.5 72c5 1x4choldamplification protocolpcr mix 2 l?dntps 8 l 2.5 mm each0.

12、2 mm each3 primer4 l10 m400 nm5 primer4 l10 m400 nmbuffer10 l10x1xh2o70 lpfu pol.2 l95c2.0 1x95c0.5 62c0.5 20x72c0.5 72c5 1x4choldproblems no product (complete failure) wrong size product (mispriming) mutations (2 out of 3 correct, 2 errors/kb)sequencing is warranted.fixes optimize pcr conditions br

13、eak gene synthesis into steps (tbio)errorsp = mutation rate / 1000 nt / duplication (cline et al., nucleic acids res 24 (1996)taq polymerase = 0.008kod (novagen) = 0.0027pfuultra (stratagene) = 0.00043the probability of a gene n bp in length having no errors using a polymerase with mutation rate p:

14、p = (1 - p)ntherefore, p for a 738 bp gene = (1 - 0.00043)738 = 0.728errorsthe number of clones needed to screen to find a correct gene with 95% confidence: n = log(0.05)/log(1-p)thus, log(0.05)/log(1-0.728) = 3 clones need to be sequenced.from wu et al., j biotech 124 (2006)time find protein of interest, design oligos, order oligos run pcr, integrate into sequencing vector, transform pick colony, grow overnight culture mini