关 键 词：

转基因 玉米 外文 文献

资源描述：

Contents lists available at ScienceDirect Food Control journal homepage Surveying genetically modified maize in foods marketed in Algeria Zahia Braraa b Joana Costaa Caterina Villaa Liliana Grazinaa Arezki Bitamc Isabel Mafraa aREQUIMTE LAQV Faculdade de Farm cia Universidade do Porto Rua de Jorge Viterbo Ferreira 228 4050 313 Porto Portugal bLRGB Ecole Nationale Sup rieure Agronomique ES1603 Alger Algeria cLTANH Ecole Nationale Sup rieure Agronomique ES1603 Alger Algeria A R T I C L E I N F O Keywords GMO detection Zea mays L Food analysis Real time PCR Quantification A B S T R A C T Despite the prohibition of the importation production distribution marketing and use of genetically modified GM plants in Algeria no legislation regarding their use in food and feed production has been established The present work describes for the first time a full stage study to monitor genetically modified organisms GMO in Algeria based on a comprehensive survey of maize derived foods providing screening event specific identifi cation and quantitative data targeting 11 maize events Bt176 Bt11 MON810 GA21 NK603 MON863 TC1507 MIR604 DAS59122 3272 and DAS40278 The results show that out of 91 maize derived samples positive for an endogenous maize gene 20 contained at least one screening GM element Six events were identified in 16 samples being MON810 NK603 and TC1507 the most frequent 16 15 and 14 of the samples respectively followed by GA21 Bt11 and DAS59122 7 6 6 6 and 2 2 respectively Interestingly out of those samples 14 had 3 5GM events while only 2 had one or 2 events The quantitative real time PCR results show very high levels of GM maize events in all samples resultant from the multiple event accounting 34 9 222 7 suggesting the presence of stacked events together with single trait ones These findings highlight the need for specific labelling legislation regarding the GMO presence in food and the ver ification of its compliance 1 Introduction The application of genetic engineering technology to food crops has achieved remarkable success by introducing characteristics of interest such as herbicide tolerance insect resistance and enhanced shelf life or modified nutritional composition Since the first genetically modified organism GMO approval in 1996 the number of genetically modified GM crops introduced to the market has been dramatically increasing as well as the number of countries involved in their production com mercialisation the diversity of novel traits and the global trade So far 31 different GM crops accounting 519 transgenic events have been authorised for food and feed production in 44 countries ISAAA 2019 The cultivation area of GM crops reached 189 8 million hectares by 2017 from which soybean and maize accounted for 50 and 30 of the total area respectively James 2017 Maize one of the most used staple food and feed ingredients is the second most cultivated GM crop with the highest number of approved events 238 ISAAA 2019 Despite the benefits claimed by their producers the introduction of GMO in the food chain has generated an intense public and scientific debate Concerns about potential risks on human health environment and biodiversity as well as the need to provide information to the consumers have driven international regulatory bodies to deal with the biosafety measures of GMO introducing food labelling regulations for consumer s protection For instance the European Union EU has es tablished specific regulation regarding GMO approval requiring the compulsory labelling for all food products consisting of produced or containing GMO above 0 9 Regulation EC No 1829 2003 In Al geria the discussion around GMO regulation and other related issues appeared with the adoption of the Cartagena protocol on biosafety The country has ratified the protocol and promulgated a regulation prohi biting importation production distribution marketing and use of ge netic GM plant materials except for research purposes Ministerial Order 2001 However no specific regulation has been established to control the presence or use of GMO in food as well as to regulate la belling The need to comply with the legislation requirements has generated interest in analytical methods for the reliable detection of GMO in food Therefore several approaches have been developed based on the identification of the introduced DNA or the encoded novel protein s Due to the high stability of DNA molecules compared to proteins and their presence in most biological tissues DNA based methods have been the premium choice for the analysis of GMO in foods Mafra 2011 https doi org 10 1016 j foodcont 2019 106928 Received 8 August 2019 Received in revised form 27 September 2019 Accepted 28 September 2019 Corresponding author E mail address isabel mafra ff up pt I Mafra Food Control 109 2020 106928 Available online 30 September 2019 0956 7135 2019 Elsevier Ltd All rights reserved T Pl cido et al 2016 Methods relying on polymerase chain reaction PCR offer sensitive specific and reliable tools for screening identifi cation and quantification of GMO at trace levels in highly processed foods Mafra Ferreira Fernandes et al 2016 In spite of the numerous analytical advances on GMO analysis the gold standard for its identification confirmation and quantification is real time PCR using specific fluorescent probes mainly the hydrolysis TaqMan probes Mafra 2011 Pl cido et al 2016 So far several studies reporting the detection of GMO in foods in cluding maize derived products have been conducted in relation to numerousmarketsaroundtheglobe Abdel Mawgood Gassem Alsadon Alghamdi Akiyama et al 2005 Al Rousan Al Hmoud Hayek Al Salameen Kumar Al Aqeel Al Hashash Arun Y lmaz Branquinho Ferreira Cardarelli Branquinho Ferreira da Cruz Chaouachi et al 2013 Dinon Bosco Dinon de Melo El Sanhoty et al 2002 Elsanhoty Al Turki Fernandes Amaral Oliveira Germini Salati Quartaroli Greiner Greiner Konietzny G rakan Herzallah 2012 Iloh Onyenekwe Kaur Radu Ghazali Kyrova Ostry Surmanova Louanchi Belalia Lehad Premanandh Maruthamuthu Sabbagh Rabiei Mehdizadeh Rastegar Vahidi Turkec Lucas Viljoen Dajee Zdjelar et al 2013 Those reports describe the application of PCR techniques to screen detect and quantify GM maize in foods However the identification confirmation and quantification of GM maize events by real time PCR methods has been performed on limited countries namely Brazil Greiner et al 2005 Greiner corn flakes 27 samples gluten free food categorised to gluten free pastas and couscous 9 samples gluten free flours and semolina 8 samples gluten free cookies 8 samples baby food 6 samples and popcorn 8 samples All the samples were triturated and homogenised in a laboratory knife mill Grindomix GM200 Retsch Haan Germany using different blender containers previously treated with DNA decontaminator solution and stored at 20 C prior to DNA extraction 2 2 Reference materials Certified reference materials CRM produced by the Institute for Reference Materials and Measurements IRMM Geel Belgium and commercialised by Fluka Buchs Switzerland were used as standards The reference materials consisted of dried powders with spiking levels of GM maize events 0 0 1 1 and 5 for Bt176 Bt11 GA21 and NK603 events 0 0 1 1 and 10 for MON863 TC1507 MIR604 and DAS59122 events 0 0 5 2 and 10 for MON810 event 0 0 5 1 and 10 for DAS40278 event 0 1 and 10 for 3272 event 2 3 DNA extraction 2 3 1 Food samples DNA from food samples was extracted by the Wizard method as described by Mafra Silva Moreira Silva and Oliveira 2008 using 100 200mg of previously grounded and homogenised sample de pending on the food matrix and processing degree The extractions were performed in duplicate assays for each sample and the extracts were kept at 20 C until further analysis Yield and purity of extracts were assessed by UV spectrophotometric DNA quantification on a Synergy HT multi mode microplate reader BioTek Instruments Inc Vermont USA using a Take3 micro volume plate accessory DNA content was determined using the nucleic acid quantification protocol with sample type defined for double strand DNA in the Gen5 data analysis software version 2 01 BioTek Instruments Inc Vermont USA Values of raw and calculated absor bencies A at 260nm 280nm and 230nm were acquired to calculate A260 A280 and A230 A260 ratios and DNA concentration in ng L The integrity of DNA extracts was evaluated by electrophoresis with 1 of agarose gel stained with 1 Gel Red Biotium CA USA and performedin1 SGTBbuffer GRISP Porto Portugal for 20 25minat 200V The agarose gel was visualised under a UV light tray Gel Doc EZ System Bio Rad Laboratories Hercules CA USA and a digital image was obtained with Image Lab software version 5 2 1 Bio Rad Laboratories Hercules CA USA 2 3 2 Reference materials DNA from reference materials was extracted by the NucleoSpin food kit Macherey Nagel D ren Germany according to manufacturer in structions with minor modifications 1h lysis incubation using 100mg of flour The extracts were kept at 20 C until further analysis DNA yield and purity were determined as described above for the food samples section 2 3 1 2 4 Oligonucleotide primers and probes The amplifiability of DNA extracts was verified by means of taxon specific PCR assays using the primer pairs IVR1 F IVR1 R or Mz F Mz R specific for invertase and zein genes respectively Table 1 The samples were then screened for the presence of GMO elements namely 35S promoter and NOS terminator using the primer sets 35S cf3 35S cf4 and HA nos118 f HA nos118 r respectively Table 1 The detec tion of MON810 Bt176 MON863 MIR604 DAS59122 3272 and DAS40278 events was specifically accomplished using the primers sets VW01 VW03 CRY03 CRY04 P863 3F P863 4R MIR604 AF MIR604 AR E3272 F E3272 R1 and DAS AF DAS AR respectively in samples positive for at least one screening element 35S promoter and or NOS terminator The detection of DAS40278 event was performed for all samples using the primers DAS40 f1 DAS40 r3 The information about primers used in qualitative PCR study is summarised in Table 1 The primer pairs Bt11 3 3 Bt11 3 5 NK F NK R GA21 FGA21 R and TC F TC R used for both qualitative PCR detection and real time quanti tative PCR of Bt11 GA21 and NK603 events respectively are presented in Table 2 In real time PCR two different maize taxon specific genes were used as reference for the GMO quantification depending on the event the starch synthase IIb SSIIb 1 5 SSIIb 1 3 primers and SSIIb Taq probe and the alcohol dehydrogenase 1 Adh1 f Adh1 R primers and Z Brara et al Food Control 109 2020 106928 2 Adh P probe genes were targeted Table 2 The primers and probes targeting the different transgenic maize lines are also presented in Table 2 The probes were labelled with FAM as fluorescent reporter and BHQ 1 as fluorescent quencher All the primers and probes were synthesised by Eurofins MWG Operon Ebersberg Germany 2 5 Qualitative PCR The qualitative PCR assays were carried out in 25 L of total reaction volume containing 2 L of DNA extract 1 buffer 67mM of Tris HCl pH 8 8 16mM of NH4 2SO4 0 1 of Tween 20 0 2mM of each dNTP except for IVR1 F IVR1 R GA21 F GA21 R DAS AF DAS AR DAS40 f1 DAS40 r3 and MIR604 AF MIR604 AR primers which used 0 4mM dNTP Grisp Porto Portugal 1 0 U of SuperHot Taq DNA Polymerase GenaxxonBioscience Ulm Germany 1 5mM IVR1 F IVR1 R CRY03 CRY04 VW01 VW03 NK F NK R GA21 F GA21 R 2 0mM Mz F Mz R 35S cf3 35S cr4 HA nos118f HA nos118r P863 3F P863 4R TC F TC R and MIR604 AF MIR604 AR 2 5mM DAS AF DAS AR DAS40 f1 DAS40 r3 or 3 0mM Bt113 5 Bt113 3 E3272 F E3272 R1 of MgCl2 0 4mM of each primer except for P863 3F P863 4R NK F NK R and TC F TC R Tables 1 and 2 and 1 U of SuperHot Taq DNA Polymerase Genaxxon Bioscience GmbH Germany PCRamplificationswereperformedinMJMini Bio Rad Laboratories Hercules CA USA or SimpliAmp Applied Biosystems foster City CA USA thermo cyclers according and the temperature programmes are presented in Table 3 The amplified fragments were analysed by electrophoresis in a 1 5 agarose gel containing 1 Gel Table 1 Oligonucleotide primers used in qualitative PCR TargetPrimerSequence 5 3 Amplicon bp Reference Maize invertase geneIVR1 FCCGCTGTATCACAAGGGCTGGTACC226ISO21569 2005 IVR1 FGGAGCCCGTGTAGAGCATGACGATC Maize zein geneMz FCGCCAGAAATCGTTTTTCAT139Germini et al 2004 Mz RGGTGGTGTCCTTGCTTCCTA CAMV 35S promotor35S cf3CCACGTCTTCAAAGCAAGTGG123ISO21569 2005 35S cr4TCCTCTCCAAATGAAATGAACTTC NOS terminatorHA nos118fCGATGACGTTATTTATGAGATGGG118ISO21569 2005 HA nos118rGACACCGCGCGCGATAATTTATCC MON810VW01TCGAAGGACGAAGGACTCTAACG178ISO21569 2005 VW03TCCATCTTTGGGACCACTGTCG Bt176CRY03CTCTCGCCGTTCATGTCCGT211ISO21569 2005 CRY04GGTCAGGCTCAGGCTGATGT GA21GA21 FTCTCCTTGATGGGCTGCA270Germini et al 2004 GA21 RACGGTGGAAGAGTTCAATGTATG MON863P863 3FGGCGATGAATAAATGAGAAATA200Pan et al 2006 P863 4RTAGCCAGTTCATTGCGAGTA DAS59122DAS AFCGCACCTGTGATTGGCTCAT116Kim Kim Lee Kim and Kim 2010 DAS ARGATTGTCGTTTCCCGCCTTC MIR604MIR604 AFCGCTCTGCGCACGCAATTCA132Kim et al 2010 MIR604 ARGGTTCTGTCAGTTCCAAACG 3272E3272 FTCATCAGACCAGATTCTCTTTTATGG95Delobel Foti Mazzara and Van Den Eede 2008 E3272 R1TGTCGTTTCCCGCCTTCAGTTTA DAS40278DAS40 f1CACGAACCATTGAGTTACAATC98Savini Bogni Foti Mazzara and Kreysa 2012 DAS40 r3TGGTTCATTGTATTCTGGCTTTG Table 2 Oligonucleotide primers and probes used in real time PCR TargetPrimer probeSequence 5 3 Concentration nM Amplicon bp Reference SSIIbaSSIIb 1 5 CTCCCAATCCTTTGACATCTGC500151ISO 21570 2005 SSIIb 1 3 TCGATTTCTCTCTTGGTGACAGG500 SSIIb TaqFAM AGCAAAGTCAGAGCGCTGCAATGCA BHQ1200 Adh1aAdh1 FCCAGCCTCATGGCCAAAG15070Mazzara 2005 Adh1 RCCTTCTTGGCGGCTTATCTG150 Adh1 PFAM CTTAGGGGCAGACTCCCGTGTTCCCT BHQ150 MON810MON810 2 5 GATGCCTTCTCCCTAGTGTTGA500113ISO 21570 2005 MON810 2 3 GGATGCACTCGTTGATGTTTG500 MON810 TaqFAM AGATACCAAGCGGCCATGGACAACAA BHQ1200 Bt11Bt11 3 5 AAAAGACCACAACAAGCCGC375127ISO 21570 2005 Bt11 3 5 CAATGCGTTCTCCACCAAGTACT375 Bt11 2 TaqFAM CGACCATGGACAACAACCCAAACATCA BHQ1200 GA21GA21 3 5 GAAGCCTCGGCAACGTCA150133ISO 21570 2005 GA21 3 3 ATCCGGTTGGAAAGCGACTT150 GA21 2 TaqFAM AAGGATCCGGTGCATGGCCG BHQ150 NK603NK FCGGCCAGCAAGCCTTGTA300113Huang et al 2004 NK RTCCCGACTCTCTTCTCAAGCA300 NK PFAM ATCACAAACCGAGAGAAGAGGGATCTCGA BHQ1200 TC1507TC FGACGTCTCAATGTAATGGTTAACGA300190La Paz et al 2006 TC RGGGTAACCGCTCTTCCAGTTGT300 TC PFAM CCGCGTTAACAAGCTTACTCGAGGTCGAGG TCATTC BHQ1150 DAS59122DAS FGGGATAAGCAAGTAAAAGCGCTC25086Mazzara et al 2006 DAS RCCTTAATTCTCCGCTCATGATCAG250 DAS PFAM TTTAAACTGAAGGCGGGAAACGACAA BHQ1100 a SSIIb starch synthase IIb gene Adh1 alcohol dehydrogenase 1 gene Z Brara et al Food Control 109 2020 106928 3 Red Biotium CA USA for staining and carried out in 1 SGTB buffer GRISP Porto Portugal for about 20 25min at 200 V The agarose gel was visualised as described in section 2 3 1 2 6 Real time PCR conditions Real time PCR assays were performed to confirm and estimate the contents of maize events previously detected by qualitative PCR For that purpose the method of double calibration curve was used for the six identifiedevents NK603 GA21 MON810 TC1507 Bt11and DAS59122 targeting the starch synthase IIb SSIIb or alcohol dehy drogenase 1 Adh1 genes as taxon specific sequences The calibration curves were obtained from 5 fold serially diluted extracts of respective CRM starting from 200ng to 0 064ng of template DNA Each set of di lutions and samples was amplified in parallel reactions targeting the event under test and a taxon specific gene for maize The SSIIb maize en dogenous gene served as a reference for the MON810 Bt11 and GA21 quantification systems as proposed by ISO 21570 and for the TC1507 due to the closeness of amplicon length The Adh1 gene was used as a re ference for the NK603 and DAS59122 events also considering the am plicon size For control and validation purposes the 1 reference mate rial of each event 2 in the case of MON810 was included in all assays The real time PCR amplifications were performed using 20 L of total reactionvolumeconsistingof2 LoftemplateDNA 1 of SsoAdvanced UniversalProbesSupermix Bio RadLaboratories Hercules CA USA primers and probes according to concentrations presented in Table 2 The real time PCR assays were performed in a CFX96 Real Time PCR Detection System Bio Rad Laboratories Her cules CA USA using the following conditions 95 C for 5min 50 cycles at 95 C for 30s and 60 C for 1min with collection of fluorescence signal at the end of each cycle Data were collected and processed by Bio Rad CFX Manager 3 1 software Bio Rad Laboratories Hercules CA USA Cycle threshold Ct values were calculated using the software at automatic threshold setting Real time PCR trials were repeated in two or three independent assays using at least three replicates in each one 3 Results and discussion More than one hundred of maize consisting or maize containing food products available at the Algerian retail trade were analysed in the present work for the detection of GMO The products were randomly acquired from different markets during 2016 and 2017 and were grouped in sweet corn corn flakes gluten free products infant cereals corn snacks and popcorn Since the majority of the samples were highly processed choosing an efficient method of extraction was of major im portance After verifying the amplifiability of the extracted DNA the samples were submitted to a screening analysis targeting the most common elements present in the GMO constructs namely 35S promoter and NOS terminator Positive samples for at least one of those two ele ments were later analysed to identify the specific events Bt176 Bt11 and GA21 NK603 MON810 MON863 TC1507 MIR604 DAS59122 and 3272 As DAS40278 event does not contain any of the referred two elements it was tested with all the samples The confirmation of each identified event was performed by real time PCR with hydrolysis probes which was also in house developed for quantitative analysis 3 1 DNA extraction and amplifiability The Wizard method which previously demonstrated to be a highly efficient DNA extraction method for processed foods including maize derived products for GMO analysis Fernandes et al 2014 Grazina et al 2017 Mafra et al 2008b Smith ENGL 2015 More over the measured trueness expressed as bias should be within 25 of the actual value ENGL 2015 Table 5 presents the summarised results of performance parameters obtained by quantitative real time PCR to estimate each GM maize event The calibration curve data show that all the assays developed for the quantification of maize DNA and each GM trait presented accep table parameters within dynamic ranges of 6 magnitude orders high lighting their high analytical performance to estimate the GM contents The use of CRM containing 1 or 2 of each spiked maize event con firmed the accuracy of the methods to estimate the identified GM maize traits since the measured trueness expressed as bias was within 25 of the actual value for all the quantification targets ENGL 2015 Be sides the precision of the methods can be confirmed based on the de termination of the coefficients of variation expressing the relative standard deviation of results under repeatability conditions which were much lower than 25 as the recommended for these assays ENGL 2015 The application of the real time PCR methods to analyse the com mercial samples Table 6 enabled confirming all the positive results regarding the event specific detection by qualitative PCR Table 4 The most representative events both in content and frequency are the Table 4 Results of qualitative PCR targeting a maize specific gene screening elements and construct event specific sequences of GM maize events from analysed food products commercialised in Algerian SamplesNumber of samplesEndogenous geneScreeningMaize Events Invertase zeinP 35StNOSMON810Bt11GA21NK603TC1507DAS59122Other eventsa Canned sweet corn2626000000000 Cornflakes2718211101100 Semolina and flours88666356610 Pastas99444004400 Cookies and tortilla88322211110 Baby food66000000000 Snacks98322012100 Pop corn88000000000 Total10191181515671

内容简介：

-