PrimerBLAST 操作说明.ppt

1、GeXP Gene Expression Multiplex Design:Using NCBI Primer-BLAST to design high performance, gene-specific primers for an XP-PCR multiplex,Updated: March 07, 2011,Two Design Strategies,Use Accession Numbers or Proprietary Genes to create gene-specific primers for amplicons 105-350 nucleotides in length

2、,The shotgun approach is an efficient method to use when little or no genome information is available for the organism of interest. Little or no homology, pseudogene or transcript variant information No SNP information No intron/exon boundaries,The strategic approach is recommended when a model orga

3、nism is used and/or there is sufficient genomic data available in NCBI for Primer-BLAST to scan primers for: Homology and/or transcript variants SNP Intron/exon boundaries are known,1,2,Accession Numbers,Strategic Approach,Pre-design considerations Choosing the gene and accession number Use only mRN

4、A accession numbers Amplicon length and space between peaks Design using NCBI Primer-BLAST Amplicon lengths Design primers to detect all transcript variants (if not specified) or a unique transcript variant (if specified) Design primers to avoid amplifying transcribed pseudogenes Design intron-spann

5、ing primers when possible Exclude SNPs from primers,Strategic Approach,Advanced Primer Design Workflow,Obtain mRNA accession numbers or use gene sequence,Check gene for transcript variants, pseudogenes and intron information: Entrez Gene (See Specific Design Considerations),Design primers using Prim

6、er BLAST,Enter primer name, fragment size, gene name into multiplex TDF file template,Determine the desired length of amplicon (without universal tags),1. Choosing an Accession Number A single gene can be represented in the NCBI database by multiple accession numbers mRNA Always use reference sequen

7、ce (RefSeq) (NM_XXXXXX) from the Database Use caution with other mRNA accession numbers - partial sequences - mutations - ESTs Do not use an accession number for genomic sequences 2. Ensure the following for each accession number that is chosen: Correct gene is chosen Multiple names and aliases Diff

8、erent genes can have similar names Species of interest If non-RefSeq accession number is used Verify that the sequence contains only the letters A, T, G, C or N,Pre-Design Considerations,Amplicon Length,Design amplicons such that each fragment is no less than 5 nucleotides apart from its nearest nei

9、ghbor. This allows for variation in migration to meet the minimum peak separation distance of 3 nucleotides. Design amplicons between 105 350 nt (without universal tags) 142 387 nt with universal tags Start with small fragment size and work toward larger fragment size Note: For FFPE samples, design

10、amplicons between 105-160 nt (without universal tags), the recommended total number of fragments in a panel is twenty or less.,Pre-Design Considerations-Continue,Gene Information Intron and Exon Information Transcript Variants Information Pseudogenes Information,Pre-Design Considerations-Continue,1.

11、 Choose the Gene database,2. Enter gene name or accession number,3. Click Search,NCBI web or directly go to /gene/,Step1: Getting Gene Information,Get the alias(es) and a summary,Example: NM_01825,View the transcripts and reference sequences,ELP2 contains a single transcrip

12、t with 22 exons Each green bar represent an exon.,ELP2 located at the Chromosome 18,Step 2: Checking for homology and pseudogenes,Perform a species-specific query,Blast human genome if it is a human gene,Go to /Blast.cgi,Enter the accession # here,Select “reference only”

13、database,Click “Begin Search”,Click “View Report”,Click View Report to view gene information,Only one hit, theres no high homologous region or pseudogenes.,Click on the link to go to the map view and intron-exon information.,Report view page,Black hash marks indicate exon-exon boundaries,NM_018255,G

14、o to /Blast.cgi Scroll down to find the Specialized BLAST, click Primer BLAST,Step3: Design Gene-Specific Primers,NCBI Primer-BLAST,This program will accomplish the following when the parameters are set properly: Check for specificity both within a species and between spe

15、cies (must add species) Include or exclude transcript variants Exclude SNPs from the primer binding sites Create intron-spanning primers and/or exon-junction primers Allows for design to specific regions within the gene or using a pre-designed primer sequences Avoids low complexity primer binding re

16、gions Note: Generally the more restrictions that are placed on the primer selection program, the fewer primers binding sites will be available This program does NOT: Check for repeat sequences within the amplicon which may lead to stutter Check for pseudogenes,Design Gene-Specific Primers with NCBI

17、Primer-BLAST,Primer-BLAST continued,Results,Primer Design continue Add the universe taq sequence to each of the gene specific primer sequence as the final primer sequence Example: Forward Sequence with the Universal Taq Sequence AGGTGACACTATAGAATATGATCGGGTCTTCCTTCATC Reverse Sequence with Universal

18、Taq Sequence GTACGACTCACTATAGGGAGCCATTAAGGCCCTTCTTTC The designed fragment size is the gene specific size plus 37bp of the universal taq, eg, the designed size is 105bp, the expected product size is 142bp.,Order primers with Universal Tags, except KanR (in buffers),1. Keep the all header columns inf

19、ormation unchanged. 2. Change a new multiplex name (cell A2) when the multiplex information was modified. 3. Primer name, GeXP product size, Gene Name and Accession number information are essential. 4. Enter same information for both Gene Name and Accession number columns. 5. Use the actual CEQ frag

20、ment size in the product size with universal taq column 6 Row 3 has to be empty 7. Keep at the last line of primer name.,Create a Multiplex from a TDF file template,What is the TDF File ? The TDF file contains the multiplex information and that links the X-Profiler Analysis with the imported GeXP cs

21、v data. A multiplex can be uploaded into eXpress Profiler from administrator account with a valid* TDF file. Unique Multiplex Name (cell A2 in Excel spreadsheet) Row 3 has to be empty Keep all the column header unchanged. Mandatory fields to be filled: Primer Name, Gene Name, Accession Number, Produ

22、ct Size w/ Universals (use GeXP final product size easier for binning!). Enter same information in the Gene Name and Accession Number (Can be gene name or accession number). Primer name do not include ()(), otherwise the quotation marks will created when you modified the TDF, the TDF will fail to be

23、 imported.,Specific Primer Design Considerations,Targeted specific transcription variants Excluded pseudogenes,Example: Targeted Primer Design for BIRC5,/gene/,Target the 5 exon1-2 to capture three variants,Go to Nucleotide home /nuccore, enter acc

24、ession #,BRC5 gene has three transcript variants,Click Graphics,Go to NCBI Nucelotide home /nuccore, enter accession # Graphic to view exon information,Example: NM_001012271, five exons,Right click the exon bar to view exon positions,Primer Designed: Specific the forward pr

25、imer and reverse positions,Primer Designed: Selected “Allow to amplify splice variants,Results,Primers targeted three transcript variants,Design primers to regions unique to the real mRNA.,Design Primers excluding the Pseudogenes,Why design primers spanning an intron?,To avoid genomic DNA interferen

26、ce from Samples resistant to DNase Samples too small to be treated with DNase Single cell analysis To minimize or eliminate RT minus control Saving for reagents and time,Note: This step is optional or sometimes impossible step for certain multiplex panel Optional when DNase treatment will be perform

27、ed routinely Impossible when gene/variant specificity is only in the 3UTR (no introns).,Plex B RT minus control,Each primer pair was designed on different exons to avoid interference from genomic DNA contamination.,No false positive,Other Considerations,Designing primers for gene family members Desi

28、gning primers for splice variants Choosing quality reference (housekeeping) genes XP-PCR Primer Specifications,Design gene-specific primers for gene family members,When gene family members are involved, proprietary sequences should be created using non-homologous sequences. If a block of non-homolog

29、ous sequence is not available, individual primer sets should be designed prior to the multiplex design. The primer should have its 3 end land in non-homologous region.,Design gene-specific primers for gene family members, when using proprietary sequence is not an option,Perform alignment Pick a reve

30、rse primer that has its 3 end land on non-homolog region Paste the primer sequence into right primer window Pick a forward primer that has its 3 end land on non-homologous region Paste the primer sequence into left primer window Click Execute This task can also be performed via Primer-BLAST at http:

31、//tools/primer-blast/index.cgi,Example: design gene-specific primer regions for CYP6Z1,Alignment of CYP6Z family,Primer Design for Splice Variants,mRNA,Common reverse primer and specific forward primers amplify multiple transcript variants,Specific reverse and forward primers amp

32、lify a single transcript variant,4,Choosing Quality Reference Genes,Equivalent expression of each reference gene over all samples (tissues, treatments, time points) examined GeXP Human ReferencePlex No psuedogenes present or target a unique region in the reference gene Use multiple (3+) reference ge

33、nes for normalization Add more than and then choose which ones to use for study,Housekeeping (Reference) Genes Primers available,TBP (NM_003194)170bp, 212bp PSCM4(NM_153001)143bp, 271bp HRT1(NM_000194)234bp CCNG1(NM_004060)278bp GUB2 (NM_000181)198bp RPLP0(NM_053275)115bp, 127bp GAPDH(NM_002046)248b

34、p Mouse mTBP(NM_013684)151bp mGUB2(NM_010368)238bp mCCNG1(NM_009831)281bp mGAPDH(NM_008084)349bp,Human,GAPDH has many pseudogenes,It is impossible to design primers around all the pseudogenes.,XP-PCR Primer Specifications Featureminoptimalmaxunit Tm*57 6063 oC Length17 2023 nt Amplicon Size105 -350n

35、t *The default values for Table of thermodynamic parameters and Salt correction formula (under advanced parameters) have been changed in NCBI Blast to values recommended in primer3 program. Table of thermodynamic parameters is changed from Breslauer et al. 1986 to SantaLucia 1998 and Salt correction formula is changed from Schildkraut and Lifson 1965 to SantaLucia 1998. As a result, the default Tm values for your p