PCR的原理和方法(全英文).ppt

1、polymerase chain reaction (PCR),Definition of PCR The basic principle of PCR PCR Frequently Asked Questions Application of PCR,Definition of PCR,PCR(polymerase chain reaction),is under the catalytic of DNA polymerase,to mother chain DNA as a template, with specific primers for the the starting point

2、 of extension, through the degeneration, annealing, extending steps, with the parent chain template DNA replicate the complementary DNA child chain in vitro .It is one of the amplification technique of DNA synthesis in vitro, can quickly specific amplificate any purpose DNA in vitro.,The basic princ

3、iple of PCR,1.PCR reaction components (1) template DNA (2) Primer (3) four kinds of deoxyribonucleotides (4) DNA polymerase (5) Reaction Buffer, Mg2+,2. PCR reactions basic steps (1) Denaturation , The hydrogen bonding between the template double chain DNA ruptured by heating, and double chain apart

4、 into a single chain. (2) Annealling , As the temperature falls, the primer and complementary area of template DNA combined into hybrid molecules.,(3) Extension, In the presence of DNA polymerase, dNTPs,Mg2+, DNA polymerase catalytic primers outspread according to the 5 to 3 direction, synthesis DNA

5、 chain that complementary with template DNA chain. The above three steps for a cycle, the product of each loop can be used as a template for the next cycle .After n cycles, the purpose of DNA plus in the form of 2n.,GGATCTAGCGTATGCTTGAAA,CCTAGATCGCATACGAACT T T,GAACTTT,GGATCTA,5,5,3,5,3,3,5,3,primer

6、1,primer2,Template DNA,Picture1, PCR primers combined with template,PCR Frequently Asked Questions,A. No amplification products 1. The cycle temperature: denaturation temperature and annealing temperature 2. The primer design 3. The activity of DNA polymerase 4. The inhibitory ingredients (protease

7、and nuclease) 5, DNA samples,B. The specific product and electrophoresis coating shaped 1. The concentration of Mg 2+ 2. Adjust the dosage of the primer, templates, and polymerase 3. Decrease the cycle number 4. Increasing the annealing temperature, annealing or extension of time,Application of PCR,1. The gene diagnosis of genetic disease 2. The diagnosis of infectious diseases (hepatitis virus) 3. The cancer gene detection 4. The application of forensi